Incidental Mutation 'R1127:Gpr33'
ID96329
Institutional Source Beutler Lab
Gene Symbol Gpr33
Ensembl Gene ENSMUSG00000035148
Gene NameG protein-coupled receptor 33
Synonyms
MMRRC Submission 039200-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1127 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location52023003-52028063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 52023469 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 262 (H262Q)
Ref Sequence ENSEMBL: ENSMUSP00000048059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040161]
Predicted Effect probably damaging
Transcript: ENSMUST00000040161
AA Change: H262Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000048059
Gene: ENSMUSG00000035148
AA Change: H262Q

DomainStartEndE-ValueType
Pfam:7tm_1 46 299 3.6e-32 PFAM
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 80.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene has been identified as an orphan chemoattractant G-protein-coupled receptors (GPCR) pseudogene. Studies have shown that the inactivated gene is present as the predominant allele in the human population. A small fraction of the human population has been found to harbor an intact allele.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,135,203 D179G probably benign Het
Adh7 C T 3: 138,221,729 A12V probably benign Het
Ankhd1 T A 18: 36,634,346 N1179K probably damaging Het
Ankrd50 T C 3: 38,457,187 T344A probably benign Het
Aplf T C 6: 87,646,291 T269A probably benign Het
C87977 G A 4: 144,207,124 T471I probably damaging Het
Cavin4 T C 4: 48,663,637 S6P probably damaging Het
Ces2g T C 8: 104,967,462 probably null Het
Cyp2c66 A T 19: 39,163,368 N176Y probably damaging Het
Dnah3 T A 7: 119,923,030 D3980V probably damaging Het
Drc7 G T 8: 95,072,788 E530D probably damaging Het
Dst A G 1: 34,275,277 T6434A probably damaging Het
Dtx3l A G 16: 35,938,757 S41P possibly damaging Het
Eef1b2 G A 1: 63,179,457 probably null Het
Eml3 C T 19: 8,936,308 T43I probably damaging Het
Fam110b T A 4: 5,799,434 L284Q probably damaging Het
Gm5538 G A 3: 59,751,893 E256K probably benign Het
Igfals T G 17: 24,880,481 L182R probably damaging Het
Lamc1 A G 1: 153,250,459 F496L possibly damaging Het
Mgea5 G A 19: 45,752,155 R914* probably null Het
Muc4 T A 16: 32,750,525 H134Q possibly damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nxn A T 11: 76,274,069 C205* probably null Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Olfr651 C A 7: 104,553,086 H56N possibly damaging Het
Pamr1 A T 2: 102,639,353 I415F possibly damaging Het
Ppp4r4 G A 12: 103,579,068 G200E probably damaging Het
Prdm16 C A 4: 154,528,799 S57I probably damaging Het
Psmd11 A G 11: 80,471,584 K157R possibly damaging Het
Ptprn2 G A 12: 117,212,008 probably null Het
Pus7 G A 5: 23,768,795 H234Y probably benign Het
Rd3l A G 12: 111,980,283 Y20H probably benign Het
Stk31 A G 6: 49,409,207 D160G probably damaging Het
Sycp2 C T 2: 178,374,366 E768K possibly damaging Het
Tango6 T C 8: 106,688,895 V116A probably benign Het
Ttn C T 2: 76,867,230 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Xylb T C 9: 119,383,377 I427T probably damaging Het
Zc3h7a T G 16: 11,139,075 D890A probably damaging Het
Other mutations in Gpr33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Gpr33 APN 12 52023560 missense probably damaging 0.98
IGL02177:Gpr33 APN 12 52024080 missense probably benign 0.00
IGL03090:Gpr33 APN 12 52024026 missense probably damaging 0.99
R0883:Gpr33 UTSW 12 52023635 missense probably benign 0.17
R1112:Gpr33 UTSW 12 52023372 missense probably damaging 1.00
R1742:Gpr33 UTSW 12 52024262 critical splice acceptor site probably null
R1967:Gpr33 UTSW 12 52024208 missense probably benign
R2208:Gpr33 UTSW 12 52023453 missense probably benign 0.00
R2917:Gpr33 UTSW 12 52023596 missense possibly damaging 0.63
R4308:Gpr33 UTSW 12 52023640 nonsense probably null
R4725:Gpr33 UTSW 12 52024109 missense probably damaging 1.00
R5616:Gpr33 UTSW 12 52023594 missense probably damaging 0.99
R7055:Gpr33 UTSW 12 52024253 start codon destroyed probably null 0.99
R7272:Gpr33 UTSW 12 52024065 missense probably damaging 0.99
R7419:Gpr33 UTSW 12 52023267 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATACTTCCATCATGGCCCATTGCTT -3'
(R):5'- TCATGCAGCCTGTTTCGTCGG -3'

Sequencing Primer
(F):5'- agccatctctcccaccc -3'
(R):5'- TGGCCACCAAGATGAAAGAG -3'
Posted On2014-01-05