Incidental Mutation 'R1127:Ppp4r4'
ID96331
Institutional Source Beutler Lab
Gene Symbol Ppp4r4
Ensembl Gene ENSMUSG00000021209
Gene Nameprotein phosphatase 4, regulatory subunit 4
Synonyms8430415E04Rik
MMRRC Submission 039200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R1127 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location103532283-103613831 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103579068 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 200 (G200E)
Ref Sequence ENSEMBL: ENSMUSP00000139786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021631] [ENSMUST00000187155] [ENSMUST00000189871] [ENSMUST00000190664]
Predicted Effect probably damaging
Transcript: ENSMUST00000021631
AA Change: G200E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021631
Gene: ENSMUSG00000021209
AA Change: G200E

DomainStartEndE-ValueType
SCOP:d1gw5a_ 55 577 6e-27 SMART
PDB:3FGA|A 178 666 8e-6 PDB
coiled coil region 690 726 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187155
AA Change: G91E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140874
Gene: ENSMUSG00000021209
AA Change: G91E

DomainStartEndE-ValueType
Pfam:HEAT 145 175 2.8e-3 PFAM
low complexity region 484 495 N/A INTRINSIC
coiled coil region 581 617 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189871
AA Change: G200E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139786
Gene: ENSMUSG00000021209
AA Change: G200E

DomainStartEndE-ValueType
SCOP:d1gw5a_ 95 577 7e-26 SMART
PDB:1B3U|B 178 666 2e-6 PDB
coiled coil region 690 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190664
SMART Domains Protein: ENSMUSP00000140295
Gene: ENSMUSG00000021209

DomainStartEndE-ValueType
Pfam:HEAT 38 68 5.8e-4 PFAM
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 80.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a HEAT-like repeat-containing protein. The HEAT repeat is a tandemly repeated, 37-47 amino acid long module occurring in a number of cytoplasmic proteins. Arrays of HEAT repeats form a rod-like helical structure and appear to function as protein-protein interaction surfaces. The repeat-containing region of this protein has some similarity to the constant regulatory domain of the protein phosphatase 2A PR65/A subunit. The encoded protein binds protein serine/threonine phosphatase 4c in the cytoplasm. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,135,203 D179G probably benign Het
Adh7 C T 3: 138,221,729 A12V probably benign Het
Ankhd1 T A 18: 36,634,346 N1179K probably damaging Het
Ankrd50 T C 3: 38,457,187 T344A probably benign Het
Aplf T C 6: 87,646,291 T269A probably benign Het
C87977 G A 4: 144,207,124 T471I probably damaging Het
Cavin4 T C 4: 48,663,637 S6P probably damaging Het
Ces2g T C 8: 104,967,462 probably null Het
Cyp2c66 A T 19: 39,163,368 N176Y probably damaging Het
Dnah3 T A 7: 119,923,030 D3980V probably damaging Het
Drc7 G T 8: 95,072,788 E530D probably damaging Het
Dst A G 1: 34,275,277 T6434A probably damaging Het
Dtx3l A G 16: 35,938,757 S41P possibly damaging Het
Eef1b2 G A 1: 63,179,457 probably null Het
Eml3 C T 19: 8,936,308 T43I probably damaging Het
Fam110b T A 4: 5,799,434 L284Q probably damaging Het
Gm5538 G A 3: 59,751,893 E256K probably benign Het
Gpr33 A C 12: 52,023,469 H262Q probably damaging Het
Igfals T G 17: 24,880,481 L182R probably damaging Het
Lamc1 A G 1: 153,250,459 F496L possibly damaging Het
Mgea5 G A 19: 45,752,155 R914* probably null Het
Muc4 T A 16: 32,750,525 H134Q possibly damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nxn A T 11: 76,274,069 C205* probably null Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Olfr651 C A 7: 104,553,086 H56N possibly damaging Het
Pamr1 A T 2: 102,639,353 I415F possibly damaging Het
Prdm16 C A 4: 154,528,799 S57I probably damaging Het
Psmd11 A G 11: 80,471,584 K157R possibly damaging Het
Ptprn2 G A 12: 117,212,008 probably null Het
Pus7 G A 5: 23,768,795 H234Y probably benign Het
Rd3l A G 12: 111,980,283 Y20H probably benign Het
Stk31 A G 6: 49,409,207 D160G probably damaging Het
Sycp2 C T 2: 178,374,366 E768K possibly damaging Het
Tango6 T C 8: 106,688,895 V116A probably benign Het
Ttn C T 2: 76,867,230 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Xylb T C 9: 119,383,377 I427T probably damaging Het
Zc3h7a T G 16: 11,139,075 D890A probably damaging Het
Other mutations in Ppp4r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Ppp4r4 APN 12 103579076 missense probably benign
IGL01388:Ppp4r4 APN 12 103576849 missense probably damaging 1.00
IGL01662:Ppp4r4 APN 12 103602966 missense possibly damaging 0.55
IGL01768:Ppp4r4 APN 12 103581405 missense probably benign 0.12
IGL01894:Ppp4r4 APN 12 103593138 missense probably damaging 1.00
IGL01921:Ppp4r4 APN 12 103576310 start codon destroyed probably null 0.01
IGL01960:Ppp4r4 APN 12 103581494 splice site probably benign
IGL02084:Ppp4r4 APN 12 103600398 missense possibly damaging 0.93
IGL02287:Ppp4r4 APN 12 103587488 missense probably benign 0.01
IGL02315:Ppp4r4 APN 12 103600361 splice site probably benign
IGL03137:Ppp4r4 APN 12 103581384 missense probably damaging 1.00
IGL03170:Ppp4r4 APN 12 103590774 intron probably benign
cataract UTSW 12 103612815 nonsense probably null
downfall UTSW 12 103593098 missense probably benign 0.00
R0114:Ppp4r4 UTSW 12 103576374 missense probably benign 0.00
R0390:Ppp4r4 UTSW 12 103601360 splice site probably benign
R0403:Ppp4r4 UTSW 12 103584102 missense probably benign
R0548:Ppp4r4 UTSW 12 103612815 nonsense probably null
R0601:Ppp4r4 UTSW 12 103600520 splice site probably benign
R0894:Ppp4r4 UTSW 12 103600495 missense probably damaging 0.99
R1177:Ppp4r4 UTSW 12 103576323 missense possibly damaging 0.82
R1378:Ppp4r4 UTSW 12 103581492 splice site probably benign
R1442:Ppp4r4 UTSW 12 103598245 missense probably damaging 0.97
R1497:Ppp4r4 UTSW 12 103606945 missense probably benign 0.07
R1651:Ppp4r4 UTSW 12 103584072 missense probably benign 0.01
R1797:Ppp4r4 UTSW 12 103598151 missense possibly damaging 0.95
R1880:Ppp4r4 UTSW 12 103605035 missense possibly damaging 0.62
R2008:Ppp4r4 UTSW 12 103585757 missense probably damaging 1.00
R2038:Ppp4r4 UTSW 12 103576280 critical splice acceptor site probably null
R2404:Ppp4r4 UTSW 12 103581490 splice site probably null
R2696:Ppp4r4 UTSW 12 103581394 missense possibly damaging 0.77
R2849:Ppp4r4 UTSW 12 103606933 missense probably benign 0.00
R2965:Ppp4r4 UTSW 12 103612821 missense probably damaging 1.00
R3030:Ppp4r4 UTSW 12 103606956 missense probably benign
R3805:Ppp4r4 UTSW 12 103600366 missense probably damaging 0.99
R3862:Ppp4r4 UTSW 12 103596421 nonsense probably null
R4194:Ppp4r4 UTSW 12 103558445 missense probably damaging 1.00
R4320:Ppp4r4 UTSW 12 103598243 missense probably damaging 1.00
R4558:Ppp4r4 UTSW 12 103606933 missense probably benign 0.00
R4783:Ppp4r4 UTSW 12 103590858 critical splice donor site probably null
R4866:Ppp4r4 UTSW 12 103600447 missense possibly damaging 0.92
R4903:Ppp4r4 UTSW 12 103590771 splice site probably null
R5309:Ppp4r4 UTSW 12 103606888 splice site probably null
R5312:Ppp4r4 UTSW 12 103606888 splice site probably null
R5381:Ppp4r4 UTSW 12 103593098 missense probably benign 0.00
R5383:Ppp4r4 UTSW 12 103584168 missense probably benign 0.14
R5447:Ppp4r4 UTSW 12 103584151 missense possibly damaging 0.67
R5942:Ppp4r4 UTSW 12 103587447 missense possibly damaging 0.92
R6339:Ppp4r4 UTSW 12 103604969 nonsense probably null
R6386:Ppp4r4 UTSW 12 103593105 missense probably damaging 1.00
R6712:Ppp4r4 UTSW 12 103596443 missense probably damaging 1.00
R6755:Ppp4r4 UTSW 12 103585737 missense probably damaging 1.00
R6868:Ppp4r4 UTSW 12 103590852 missense probably damaging 1.00
R6879:Ppp4r4 UTSW 12 103551920 intron probably null
R7355:Ppp4r4 UTSW 12 103604582 nonsense probably null
R7397:Ppp4r4 UTSW 12 103612806 critical splice acceptor site probably null
R7447:Ppp4r4 UTSW 12 103585726 missense possibly damaging 0.46
R7576:Ppp4r4 UTSW 12 103596449 missense probably damaging 0.97
R7653:Ppp4r4 UTSW 12 103584145 missense probably damaging 0.98
R7683:Ppp4r4 UTSW 12 103587105 nonsense probably null
R7748:Ppp4r4 UTSW 12 103605061 critical splice donor site probably null
R7831:Ppp4r4 UTSW 12 103590821 missense possibly damaging 0.76
R7833:Ppp4r4 UTSW 12 103598148 missense probably benign 0.03
R7914:Ppp4r4 UTSW 12 103590821 missense possibly damaging 0.76
R7916:Ppp4r4 UTSW 12 103598148 missense probably benign 0.03
X0025:Ppp4r4 UTSW 12 103600480 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTGCATTTGTCACTTGCCAAGAAG -3'
(R):5'- CTCCCAAGAAACCATAGTGTGGGATTG -3'

Sequencing Primer
(F):5'- TTGTCACTTGCCAAGAAGACAAAG -3'
(R):5'- CCAGTAAGTAGACTCTTGTCTGAG -3'
Posted On2014-01-05