Mutagenetix > Incidental Mutation

Incidental Mutation 'R1127:Ptprn2'

96335

Institutional Source

Beutler Lab

Gene Symbol

Ptprn2

Ensembl Gene

ENSMUSG00000056553

Gene Name

protein tyrosine phosphatase, receptor type, N polypeptide 2

Synonyms

phogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta

MMRRC Submission

039200-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.168) question?

Stock #

R1127 (G1)

Quality Score

204

Status

Not validated

Chromosome

Chromosomal Location

116485720-117276849 bp(+) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to A at 117212008 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000064046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]

AlphaFold

P80560

Predicted Effect

probably null
Transcript: ENSMUST00000070733

SMART Domains

Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	495	583	1.5e-35	PFAM
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	993	4.42e-119	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190247

SMART Domains

Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	494	584	2.5e-43	PFAM
transmembrane domain	602	624	N/A	INTRINSIC
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	932	8.81e-64	SMART

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 93.1%
20x: 80.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700088E04Rik	T	C	15: 79,135,203	D179G	probably benign	Het
Adh7	C	T	3: 138,221,729	A12V	probably benign	Het
Ankhd1	T	A	18: 36,634,346	N1179K	probably damaging	Het
Ankrd50	T	C	3: 38,457,187	T344A	probably benign	Het
Aplf	T	C	6: 87,646,291	T269A	probably benign	Het
C87977	G	A	4: 144,207,124	T471I	probably damaging	Het
Cavin4	T	C	4: 48,663,637	S6P	probably damaging	Het
Ces2g	T	C	8: 104,967,462		probably null	Het
Cyp2c66	A	T	19: 39,163,368	N176Y	probably damaging	Het
Dnah3	T	A	7: 119,923,030	D3980V	probably damaging	Het
Drc7	G	T	8: 95,072,788	E530D	probably damaging	Het
Dst	A	G	1: 34,275,277	T6434A	probably damaging	Het
Dtx3l	A	G	16: 35,938,757	S41P	possibly damaging	Het
Eef1b2	G	A	1: 63,179,457		probably null	Het
Eml3	C	T	19: 8,936,308	T43I	probably damaging	Het
Fam110b	T	A	4: 5,799,434	L284Q	probably damaging	Het
Gm5538	G	A	3: 59,751,893	E256K	probably benign	Het
Gpr33	A	C	12: 52,023,469	H262Q	probably damaging	Het
Igfals	T	G	17: 24,880,481	L182R	probably damaging	Het
Lamc1	A	G	1: 153,250,459	F496L	possibly damaging	Het
Mgea5	G	A	19: 45,752,155	R914*	probably null	Het
Muc4	T	A	16: 32,750,525	H134Q	possibly damaging	Het
Nckap1	C	T	2: 80,517,942	S889N	probably benign	Het
Nxn	A	T	11: 76,274,069	C205*	probably null	Het
Olfr323	T	C	11: 58,625,458	E196G	probably damaging	Het
Olfr651	C	A	7: 104,553,086	H56N	possibly damaging	Het
Pamr1	A	T	2: 102,639,353	I415F	possibly damaging	Het
Ppp4r4	G	A	12: 103,579,068	G200E	probably damaging	Het
Prdm16	C	A	4: 154,528,799	S57I	probably damaging	Het
Psmd11	A	G	11: 80,471,584	K157R	possibly damaging	Het
Pus7	G	A	5: 23,768,795	H234Y	probably benign	Het
Rd3l	A	G	12: 111,980,283	Y20H	probably benign	Het
Stk31	A	G	6: 49,409,207	D160G	probably damaging	Het
Sycp2	C	T	2: 178,374,366	E768K	possibly damaging	Het
Tango6	T	C	8: 106,688,895	V116A	probably benign	Het
Ttn	C	T	2: 76,867,230		probably benign	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Xylb	T	C	9: 119,383,377	I427T	probably damaging	Het
Zc3h7a	T	G	16: 11,139,075	D890A	probably damaging	Het

Other mutations in Ptprn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01695:Ptprn2	APN	12	116841388	missense	probably benign	0.02
IGL01788:Ptprn2	APN	12	116900987	missense	probably damaging	0.98
IGL02172:Ptprn2	APN	12	116873697	splice site	probably benign
IGL02339:Ptprn2	APN	12	116722104	missense	probably damaging	1.00
IGL02706:Ptprn2	APN	12	116888898	missense	probably damaging	0.96
IGL03018:Ptprn2	APN	12	117211943	missense	probably damaging	1.00
IGL03267:Ptprn2	APN	12	116876344	nonsense	probably null
BB001:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
BB011:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
IGL03014:Ptprn2	UTSW	12	117248688	missense	probably damaging	1.00
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0115:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0132:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0481:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0694:Ptprn2	UTSW	12	116824355	missense	possibly damaging	0.69
R0698:Ptprn2	UTSW	12	116722130	nonsense	probably null
R0746:Ptprn2	UTSW	12	116901017	missense	probably benign	0.00
R1443:Ptprn2	UTSW	12	117253615	missense	probably damaging	1.00
R1508:Ptprn2	UTSW	12	117184722	missense	probably damaging	1.00
R1664:Ptprn2	UTSW	12	117161709	missense	probably damaging	0.99
R1670:Ptprn2	UTSW	12	116722172	missense	possibly damaging	0.64
R1749:Ptprn2	UTSW	12	116580428	missense	probably benign	0.00
R2075:Ptprn2	UTSW	12	117247717	missense	probably benign	0.01
R3054:Ptprn2	UTSW	12	116722133	missense	probably damaging	1.00
R3107:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3109:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3552:Ptprn2	UTSW	12	116888877	missense	probably benign	0.00
R4193:Ptprn2	UTSW	12	116901008	missense	probably benign	0.01
R4523:Ptprn2	UTSW	12	116876000	missense	probably damaging	1.00
R4706:Ptprn2	UTSW	12	116872094	missense	probably benign	0.02
R4719:Ptprn2	UTSW	12	116824396	missense	possibly damaging	0.95
R4726:Ptprn2	UTSW	12	117247773	nonsense	probably null
R4872:Ptprn2	UTSW	12	117161694	missense	probably damaging	1.00
R4891:Ptprn2	UTSW	12	117233365	splice site	probably null
R4970:Ptprn2	UTSW	12	117276595	missense	probably damaging	1.00
R5208:Ptprn2	UTSW	12	116858928	missense	probably damaging	1.00
R5287:Ptprn2	UTSW	12	117211862	missense	probably damaging	1.00
R5419:Ptprn2	UTSW	12	117184647	missense	probably damaging	0.99
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6180:Ptprn2	UTSW	12	116859119	missense	probably benign	0.05
R6277:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R6465:Ptprn2	UTSW	12	117269589	missense	probably damaging	0.96
R6488:Ptprn2	UTSW	12	116872038	missense	probably benign	0.13
R6555:Ptprn2	UTSW	12	117227200	missense	probably damaging	1.00
R6908:Ptprn2	UTSW	12	116888888	missense	probably benign	0.06
R7120:Ptprn2	UTSW	12	116872056	missense	probably benign	0.01
R7229:Ptprn2	UTSW	12	117227225	splice site	probably null
R7237:Ptprn2	UTSW	12	117161727	missense	probably benign	0.03
R7304:Ptprn2	UTSW	12	117248544	missense	probably damaging	1.00
R7355:Ptprn2	UTSW	12	116858951	missense	probably benign
R7460:Ptprn2	UTSW	12	117248681	missense	probably benign	0.05
R7577:Ptprn2	UTSW	12	116485866	start codon destroyed	probably null
R7658:Ptprn2	UTSW	12	116722119	missense	probably benign	0.01
R7666:Ptprn2	UTSW	12	116841320	missense	probably benign	0.10
R7924:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
R8219:Ptprn2	UTSW	12	117184737	missense	probably benign	0.30
R8716:Ptprn2	UTSW	12	117255548	missense	possibly damaging	0.73
R9235:Ptprn2	UTSW	12	117269651	critical splice donor site	probably null
R9605:Ptprn2	UTSW	12	117161658	missense	probably benign	0.13
X0066:Ptprn2	UTSW	12	117161760	missense	probably damaging	1.00
X0066:Ptprn2	UTSW	12	117184740	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- ACACTTAGCCTGTCAGGGAGCTAC -3'
(R):5'- AACTCTATGCTAATGACCATGCCCG -3'

Sequencing Primer
(F):5'- CTGGGATAATGACATACTCCATGC -3'
(R):5'- TCATAGGGATAGTTCCCACTAGG -3'

Posted On

2014-01-05