Incidental Mutation 'R1016:Mdh1'
ID96338
Institutional Source Beutler Lab
Gene Symbol Mdh1
Ensembl Gene ENSMUSG00000020321
Gene Namemalate dehydrogenase 1, NAD (soluble)
SynonymsMor2, MDH-s, Mor-2, B230377B03Rik
MMRRC Submission 039120-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1016 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location21556787-21572367 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21559769 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 202 (L202P)
Ref Sequence ENSEMBL: ENSMUSP00000099938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102874] [ENSMUST00000125302]
Predicted Effect probably benign
Transcript: ENSMUST00000102874
AA Change: L202P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000099938
Gene: ENSMUSG00000020321
AA Change: L202P

DomainStartEndE-ValueType
Pfam:Ldh_1_N 5 153 7.3e-41 PFAM
Pfam:Ldh_1_C 156 331 1.2e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125302
SMART Domains Protein: ENSMUSP00000119816
Gene: ENSMUSG00000020321

DomainStartEndE-ValueType
Pfam:Ldh_1_N 5 153 5e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175427
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.6%
  • 20x: 84.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme that catalyzes the NAD/NADH-dependent, reversible oxidation of malate to oxaloacetate in many metabolic pathways, including the citric acid cycle. Two main isozymes are known to exist in eukaryotic cells: one is found in the mitochondrial matrix and the other in the cytoplasm. This gene encodes the cytosolic isozyme, which plays a key role in the malate-aspartate shuttle that allows malate to pass through the mitochondrial membrane to be transformed into oxaloacetate for further cellular processes. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is localized in the peroxisomes. A pseudogene has been identified on chromosomes 12. [provided by RefSeq, Feb 2016]
PHENOTYPE: An ENU-induced mutation results in prenatal lethality in homozygotes and decreased enzyme activity in heterozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ceacam20 T A 7: 19,976,302 H6Q probably null Het
Clstn1 T C 4: 149,646,829 I866T probably benign Het
Cntnap1 T C 11: 101,177,507 V86A probably damaging Het
Crtc1 A T 8: 70,392,119 Y351* probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cyp2j12 C T 4: 96,112,865 probably null Het
Dmrt2 A T 19: 25,675,574 K183N probably damaging Het
Fancl G T 11: 26,387,195 probably benign Het
Fbxo40 G A 16: 36,969,177 Q524* probably null Het
Flcn T C 11: 59,795,865 probably null Het
Gm19965 T A 1: 116,821,301 C237* probably null Het
Hpf1 A G 8: 60,895,644 Y131C possibly damaging Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mtus1 A G 8: 41,050,026 V784A probably benign Het
Myg1 T C 15: 102,334,351 I159T possibly damaging Het
Nans T C 4: 46,500,716 Y203H probably benign Het
Ncapg2 G A 12: 116,438,675 C709Y probably damaging Het
Olfr883 T C 9: 38,026,691 V295A probably damaging Het
Parp12 T C 6: 39,111,726 Y192C probably damaging Het
Plekha6 A G 1: 133,260,094 N118D probably benign Het
Prg4 T C 1: 150,454,691 probably benign Het
Psip1 T C 4: 83,459,898 T454A possibly damaging Het
Ptprz1 T C 6: 23,000,974 L1021P probably damaging Het
Pvr T C 7: 19,909,217 I364V probably benign Het
Serpina5 A G 12: 104,105,323 I396M probably damaging Het
Sgcb A C 5: 73,639,840 H192Q probably benign Het
Slc4a9 C A 18: 36,531,425 H379N probably benign Het
Tet1 T C 10: 62,879,950 D22G probably benign Het
Trim34a T C 7: 104,247,960 V77A probably benign Het
Ttc7b T C 12: 100,403,358 E384G probably null Het
Vmn2r16 G A 5: 109,339,888 G209D probably damaging Het
Other mutations in Mdh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02171:Mdh1 APN 11 21557438 utr 3 prime probably benign
IGL02273:Mdh1 APN 11 21559786 missense probably benign 0.38
IGL03198:Mdh1 APN 11 21564168 missense probably damaging 1.00
PIT4480001:Mdh1 UTSW 11 21558538 missense probably damaging 1.00
R0771:Mdh1 UTSW 11 21557550 missense probably benign 0.27
R3854:Mdh1 UTSW 11 21559281 missense probably benign 0.31
R3855:Mdh1 UTSW 11 21559281 missense probably benign 0.31
R3886:Mdh1 UTSW 11 21559832 missense probably damaging 0.97
R4474:Mdh1 UTSW 11 21566624 missense possibly damaging 0.49
R4507:Mdh1 UTSW 11 21558470 missense probably benign 0.01
R4724:Mdh1 UTSW 11 21562957 missense probably damaging 1.00
R4986:Mdh1 UTSW 11 21558545 missense possibly damaging 0.85
R5472:Mdh1 UTSW 11 21559786 missense probably benign 0.38
R7088:Mdh1 UTSW 11 21558484 missense probably damaging 1.00
X0063:Mdh1 UTSW 11 21562870 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATGGCTGAAAGAGGTCCCTCCAAC -3'
(R):5'- CTTGCTGAGCAGTAACATTTGCCC -3'

Sequencing Primer
(F):5'- GTGTCATAGATCAGGTCACATCAG -3'
(R):5'- CCAAGTCCGTGTAGCTTAATG -3'
Posted On2014-01-05