Incidental Mutation 'R1016:Fancl'
ID96340
Institutional Source Beutler Lab
Gene Symbol Fancl
Ensembl Gene ENSMUSG00000004018
Gene NameFanconi anemia, complementation group L
SynonymsB230118H11Rik, 2010322C19Rik, Phf9, Pog, gcd
MMRRC Submission 039120-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #R1016 (G1)
Quality Score151
Status Not validated
Chromosome11
Chromosomal Location26386135-26471876 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 26387195 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004120] [ENSMUST00000109509] [ENSMUST00000136830]
Predicted Effect probably benign
Transcript: ENSMUST00000004120
SMART Domains Protein: ENSMUSP00000004120
Gene: ENSMUSG00000004018

DomainStartEndE-ValueType
Pfam:WD-3 11 295 1.1e-106 PFAM
FANCL_C 303 371 7.55e-44 SMART
RING 307 362 2.77e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109509
SMART Domains Protein: ENSMUSP00000105135
Gene: ENSMUSG00000004018

DomainStartEndE-ValueType
Pfam:WD-3 8 290 2.4e-116 PFAM
FANCL_C 298 366 7.55e-44 SMART
RING 302 357 2.77e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136830
SMART Domains Protein: ENSMUSP00000117073
Gene: ENSMUSG00000004018

DomainStartEndE-ValueType
Pfam:WD-3 8 75 7.8e-26 PFAM
Pfam:WD-3 71 123 4.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143471
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.6%
  • 20x: 84.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the complementation group L subunit of the multimeric Fanconi anemia (FA) nuclear complex composed of proteins encoded by over ten Fanconi anemia complementation (FANC) group genes. The FA complex is necessary for protection against DNA damage. This gene product, an E3 ubiquitin ligase, catalyzes and is required for the monoubiquitination of the protein encoded by the Fanconi anemia, complementation group D2 gene, a critical step in the FA pathway (PMID: 12973351, 21229326). In mouse, mutations of this E3 ubiquitin ligase gene can lead to infertility in adult males and females, and a deletion of this gene can cause embryonic lethality in some genetic backgrounds. A pseudogene of this gene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygosity for mutations that inactivate the allele results in male and female infertility due to a defects in primordial germ cell proliferation. Homozygosity is embryonic lethal on some backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ceacam20 T A 7: 19,976,302 H6Q probably null Het
Clstn1 T C 4: 149,646,829 I866T probably benign Het
Cntnap1 T C 11: 101,177,507 V86A probably damaging Het
Crtc1 A T 8: 70,392,119 Y351* probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cyp2j12 C T 4: 96,112,865 probably null Het
Dmrt2 A T 19: 25,675,574 K183N probably damaging Het
Fbxo40 G A 16: 36,969,177 Q524* probably null Het
Flcn T C 11: 59,795,865 probably null Het
Gm19965 T A 1: 116,821,301 C237* probably null Het
Hpf1 A G 8: 60,895,644 Y131C possibly damaging Het
Mdh1 A G 11: 21,559,769 L202P probably benign Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mtus1 A G 8: 41,050,026 V784A probably benign Het
Myg1 T C 15: 102,334,351 I159T possibly damaging Het
Nans T C 4: 46,500,716 Y203H probably benign Het
Ncapg2 G A 12: 116,438,675 C709Y probably damaging Het
Olfr883 T C 9: 38,026,691 V295A probably damaging Het
Parp12 T C 6: 39,111,726 Y192C probably damaging Het
Plekha6 A G 1: 133,260,094 N118D probably benign Het
Prg4 T C 1: 150,454,691 probably benign Het
Psip1 T C 4: 83,459,898 T454A possibly damaging Het
Ptprz1 T C 6: 23,000,974 L1021P probably damaging Het
Pvr T C 7: 19,909,217 I364V probably benign Het
Serpina5 A G 12: 104,105,323 I396M probably damaging Het
Sgcb A C 5: 73,639,840 H192Q probably benign Het
Slc4a9 C A 18: 36,531,425 H379N probably benign Het
Tet1 T C 10: 62,879,950 D22G probably benign Het
Trim34a T C 7: 104,247,960 V77A probably benign Het
Ttc7b T C 12: 100,403,358 E384G probably null Het
Vmn2r16 G A 5: 109,339,888 G209D probably damaging Het
Other mutations in Fancl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00755:Fancl APN 11 26470916 missense probably benign
IGL01940:Fancl APN 11 26459752 missense probably damaging 0.99
IGL02681:Fancl APN 11 26468722 splice site probably null
IGL03063:Fancl APN 11 26387299 missense probably damaging 1.00
R0006:Fancl UTSW 11 26469695 missense possibly damaging 0.46
R0006:Fancl UTSW 11 26469695 missense possibly damaging 0.46
R0218:Fancl UTSW 11 26471337 missense probably benign 0.30
R1802:Fancl UTSW 11 26459709 missense probably benign 0.01
R2018:Fancl UTSW 11 26422459 missense probably damaging 1.00
R2121:Fancl UTSW 11 26459841 splice site probably benign
R4579:Fancl UTSW 11 26468423 splice site probably null
R5472:Fancl UTSW 11 26469677 missense probably damaging 1.00
R5495:Fancl UTSW 11 26397801 missense probably damaging 1.00
R6425:Fancl UTSW 11 26399680 missense probably damaging 1.00
R7114:Fancl UTSW 11 26407615 missense probably damaging 1.00
R7139:Fancl UTSW 11 26403358 missense probably benign 0.01
R7302:Fancl UTSW 11 26403363 missense probably damaging 0.98
R7324:Fancl UTSW 11 26403362 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACACTGTAAATGCCCTGTCAAAG -3'
(R):5'- CCGCCGTGATGAACTCTGGTTAAG -3'

Sequencing Primer
(F):5'- TGCCCTGTCAAAGTAGGAAAGTC -3'
(R):5'- TCTGGTTAAGACCTACAGAACTGC -3'
Posted On2014-01-05