Incidental Mutation 'R1127:1700088E04Rik'
ID96347
Institutional Source Beutler Lab
Gene Symbol 1700088E04Rik
Ensembl Gene ENSMUSG00000033029
Gene NameRIKEN cDNA 1700088E04 gene
SynonymsMus EST J0827E04
MMRRC Submission 039200-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1127 (G1)
Quality Score104
Status Not validated
Chromosome15
Chromosomal Location79129349-79141253 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79135203 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 179 (D179G)
Ref Sequence ENSEMBL: ENSMUSP00000140611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040320] [ENSMUST00000169604] [ENSMUST00000186053] [ENSMUST00000186459] [ENSMUST00000187550] [ENSMUST00000188562] [ENSMUST00000189761] [ENSMUST00000190509] [ENSMUST00000190730] [ENSMUST00000190959] [ENSMUST00000229031]
Predicted Effect probably benign
Transcript: ENSMUST00000040320
SMART Domains Protein: ENSMUSP00000042053
Gene: ENSMUSG00000033039

DomainStartEndE-ValueType
CH 4 103 5.64e-19 SMART
low complexity region 113 135 N/A INTRINSIC
LIM 164 219 1.15e-5 SMART
low complexity region 241 250 N/A INTRINSIC
low complexity region 375 394 N/A INTRINSIC
low complexity region 414 467 N/A INTRINSIC
low complexity region 477 497 N/A INTRINSIC
low complexity region 515 530 N/A INTRINSIC
low complexity region 571 586 N/A INTRINSIC
DUF3585 685 825 5.07e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169604
AA Change: D200G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129244
Gene: ENSMUSG00000033029
AA Change: D200G

DomainStartEndE-ValueType
Pfam:UPF0193 4 213 3.2e-92 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185944
Predicted Effect probably benign
Transcript: ENSMUST00000186053
SMART Domains Protein: ENSMUSP00000140261
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 1 58 3.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186459
SMART Domains Protein: ENSMUSP00000139974
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 1 54 5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186559
Predicted Effect unknown
Transcript: ENSMUST00000187550
AA Change: D139G
SMART Domains Protein: ENSMUSP00000140978
Gene: ENSMUSG00000033029
AA Change: D139G

DomainStartEndE-ValueType
Pfam:UPF0193 1 57 2.1e-22 PFAM
Pfam:UPF0193 54 155 8.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188562
AA Change: D27G

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000189761
SMART Domains Protein: ENSMUSP00000139736
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 1 39 4.9e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190400
Predicted Effect probably benign
Transcript: ENSMUST00000190509
AA Change: D179G

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140611
Gene: ENSMUSG00000033029
AA Change: D179G

DomainStartEndE-ValueType
Pfam:UPF0193 33 195 4.4e-46 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000190730
AA Change: D139G
SMART Domains Protein: ENSMUSP00000139884
Gene: ENSMUSG00000033029
AA Change: D139G

DomainStartEndE-ValueType
Pfam:UPF0193 1 57 2.1e-22 PFAM
Pfam:UPF0193 54 155 8.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190959
AA Change: D200G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000140347
Gene: ENSMUSG00000033029
AA Change: D200G

DomainStartEndE-ValueType
Pfam:UPF0193 1 216 1.5e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191006
Predicted Effect probably benign
Transcript: ENSMUST00000229031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230202
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230779
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 80.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh7 C T 3: 138,221,729 A12V probably benign Het
Ankhd1 T A 18: 36,634,346 N1179K probably damaging Het
Ankrd50 T C 3: 38,457,187 T344A probably benign Het
Aplf T C 6: 87,646,291 T269A probably benign Het
C87977 G A 4: 144,207,124 T471I probably damaging Het
Cavin4 T C 4: 48,663,637 S6P probably damaging Het
Ces2g T C 8: 104,967,462 probably null Het
Cyp2c66 A T 19: 39,163,368 N176Y probably damaging Het
Dnah3 T A 7: 119,923,030 D3980V probably damaging Het
Drc7 G T 8: 95,072,788 E530D probably damaging Het
Dst A G 1: 34,275,277 T6434A probably damaging Het
Dtx3l A G 16: 35,938,757 S41P possibly damaging Het
Eef1b2 G A 1: 63,179,457 probably null Het
Eml3 C T 19: 8,936,308 T43I probably damaging Het
Fam110b T A 4: 5,799,434 L284Q probably damaging Het
Gm5538 G A 3: 59,751,893 E256K probably benign Het
Gpr33 A C 12: 52,023,469 H262Q probably damaging Het
Igfals T G 17: 24,880,481 L182R probably damaging Het
Lamc1 A G 1: 153,250,459 F496L possibly damaging Het
Mgea5 G A 19: 45,752,155 R914* probably null Het
Muc4 T A 16: 32,750,525 H134Q possibly damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nxn A T 11: 76,274,069 C205* probably null Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Olfr651 C A 7: 104,553,086 H56N possibly damaging Het
Pamr1 A T 2: 102,639,353 I415F possibly damaging Het
Ppp4r4 G A 12: 103,579,068 G200E probably damaging Het
Prdm16 C A 4: 154,528,799 S57I probably damaging Het
Psmd11 A G 11: 80,471,584 K157R possibly damaging Het
Ptprn2 G A 12: 117,212,008 probably null Het
Pus7 G A 5: 23,768,795 H234Y probably benign Het
Rd3l A G 12: 111,980,283 Y20H probably benign Het
Stk31 A G 6: 49,409,207 D160G probably damaging Het
Sycp2 C T 2: 178,374,366 E768K possibly damaging Het
Tango6 T C 8: 106,688,895 V116A probably benign Het
Ttn C T 2: 76,867,230 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Xylb T C 9: 119,383,377 I427T probably damaging Het
Zc3h7a T G 16: 11,139,075 D890A probably damaging Het
Other mutations in 1700088E04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:1700088E04Rik APN 15 79139253 missense possibly damaging 0.88
R2184:1700088E04Rik UTSW 15 79135189 missense probably damaging 1.00
R4832:1700088E04Rik UTSW 15 79135209 missense probably damaging 1.00
R6870:1700088E04Rik UTSW 15 79136408 missense probably benign 0.00
R7798:1700088E04Rik UTSW 15 79135732 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGACACTGTTTCATGCCACAGGAC -3'
(R):5'- ATCTTTGCCACTGGGAAGGACAAG -3'

Sequencing Primer
(F):5'- TTTCATGCCACAGGACAAAGC -3'
(R):5'- gtgtgtgtgtgtAGAACTGATG -3'
Posted On2014-01-05