Incidental Mutation 'R1016:Serpina5'
ID96348
Institutional Source Beutler Lab
Gene Symbol Serpina5
Ensembl Gene ENSMUSG00000041550
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 5
Synonymsalpha-1 antiproteinase, Pci, PAI-3, antitrypsin
MMRRC Submission 039120-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1016 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location104101113-104106137 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104105323 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 396 (I396M)
Ref Sequence ENSEMBL: ENSMUSP00000021495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021495]
Predicted Effect probably damaging
Transcript: ENSMUST00000021495
AA Change: I396M

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021495
Gene: ENSMUSG00000041550
AA Change: I396M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SERPIN 48 405 1.4e-160 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175615
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.6%
  • 20x: 84.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of proteins, a group of proteins that inhibit serine proteases. This gene is one in a cluster of serpin genes located on the q arm of chromosome 14. This family member is a glycoprotein that can inhibit several serine proteases, including protein C and various plasminogen activators and kallikreins, and it thus plays diverse roles in hemostasis and thrombosis in multiple organs. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene are phenotypically normal with the exception that males are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ceacam20 T A 7: 19,976,302 H6Q probably null Het
Clstn1 T C 4: 149,646,829 I866T probably benign Het
Cntnap1 T C 11: 101,177,507 V86A probably damaging Het
Crtc1 A T 8: 70,392,119 Y351* probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cyp2j12 C T 4: 96,112,865 probably null Het
Dmrt2 A T 19: 25,675,574 K183N probably damaging Het
Fancl G T 11: 26,387,195 probably benign Het
Fbxo40 G A 16: 36,969,177 Q524* probably null Het
Flcn T C 11: 59,795,865 probably null Het
Gm19965 T A 1: 116,821,301 C237* probably null Het
Hpf1 A G 8: 60,895,644 Y131C possibly damaging Het
Mdh1 A G 11: 21,559,769 L202P probably benign Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mtus1 A G 8: 41,050,026 V784A probably benign Het
Myg1 T C 15: 102,334,351 I159T possibly damaging Het
Nans T C 4: 46,500,716 Y203H probably benign Het
Ncapg2 G A 12: 116,438,675 C709Y probably damaging Het
Olfr883 T C 9: 38,026,691 V295A probably damaging Het
Parp12 T C 6: 39,111,726 Y192C probably damaging Het
Plekha6 A G 1: 133,260,094 N118D probably benign Het
Prg4 T C 1: 150,454,691 probably benign Het
Psip1 T C 4: 83,459,898 T454A possibly damaging Het
Ptprz1 T C 6: 23,000,974 L1021P probably damaging Het
Pvr T C 7: 19,909,217 I364V probably benign Het
Sgcb A C 5: 73,639,840 H192Q probably benign Het
Slc4a9 C A 18: 36,531,425 H379N probably benign Het
Tet1 T C 10: 62,879,950 D22G probably benign Het
Trim34a T C 7: 104,247,960 V77A probably benign Het
Ttc7b T C 12: 100,403,358 E384G probably null Het
Vmn2r16 G A 5: 109,339,888 G209D probably damaging Het
Other mutations in Serpina5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Serpina5 APN 12 104105220 missense probably damaging 1.00
IGL01138:Serpina5 APN 12 104103744 missense possibly damaging 0.60
IGL01526:Serpina5 APN 12 104101890 missense probably damaging 1.00
IGL02159:Serpina5 APN 12 104105298 missense possibly damaging 0.95
IGL02351:Serpina5 APN 12 104102125 missense probably damaging 1.00
IGL02358:Serpina5 APN 12 104102125 missense probably damaging 1.00
IGL02735:Serpina5 APN 12 104103857 missense probably benign 0.21
IGL03087:Serpina5 APN 12 104101733 missense probably benign 0.01
R0189:Serpina5 UTSW 12 104103330 missense probably damaging 1.00
R0304:Serpina5 UTSW 12 104103200 missense possibly damaging 0.76
R0492:Serpina5 UTSW 12 104102133 missense probably damaging 1.00
R0511:Serpina5 UTSW 12 104103362 missense probably benign 0.00
R0611:Serpina5 UTSW 12 104103787 missense probably benign
R1649:Serpina5 UTSW 12 104105225 missense possibly damaging 0.94
R1970:Serpina5 UTSW 12 104103857 missense probably benign 0.02
R4429:Serpina5 UTSW 12 104103406 missense probably benign 0.00
R4805:Serpina5 UTSW 12 104102201 missense probably damaging 0.97
R5608:Serpina5 UTSW 12 104103744 missense probably damaging 1.00
R6226:Serpina5 UTSW 12 104101778 missense possibly damaging 0.72
R7097:Serpina5 UTSW 12 104102295 critical splice donor site probably null
R7357:Serpina5 UTSW 12 104103380 missense possibly damaging 0.85
R8208:Serpina5 UTSW 12 104105273 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCACAAATCCATGATGGAGGTTGAAG -3'
(R):5'- TCTCACAGGTTGCTGAATGGGC -3'

Sequencing Primer
(F):5'- TTGAAGAGTCAGGAACCACAGC -3'
(R):5'- gtaggaccttggagaaatctagtg -3'
Posted On2014-01-05