Incidental Mutation 'R1127:Vmn2r114'
ID96357
Institutional Source Beutler Lab
Gene Symbol Vmn2r114
Ensembl Gene ENSMUSG00000091945
Gene Namevomeronasal 2, receptor 114
SynonymsEG666002
MMRRC Submission 039200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R1127 (G1)
Quality Score109
Status Not validated
Chromosome17
Chromosomal Location23290934-23312313 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) ATTT to ATT at 23290932 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168033]
Predicted Effect probably null
Transcript: ENSMUST00000168033
SMART Domains Protein: ENSMUSP00000127505
Gene: ENSMUSG00000091945

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 154 470 1.5e-24 PFAM
Pfam:NCD3G 511 564 1.5e-18 PFAM
Pfam:7tm_3 597 832 1.4e-55 PFAM
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 80.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,135,203 D179G probably benign Het
Adh7 C T 3: 138,221,729 A12V probably benign Het
Ankhd1 T A 18: 36,634,346 N1179K probably damaging Het
Ankrd50 T C 3: 38,457,187 T344A probably benign Het
Aplf T C 6: 87,646,291 T269A probably benign Het
C87977 G A 4: 144,207,124 T471I probably damaging Het
Cavin4 T C 4: 48,663,637 S6P probably damaging Het
Ces2g T C 8: 104,967,462 probably null Het
Cyp2c66 A T 19: 39,163,368 N176Y probably damaging Het
Dnah3 T A 7: 119,923,030 D3980V probably damaging Het
Drc7 G T 8: 95,072,788 E530D probably damaging Het
Dst A G 1: 34,275,277 T6434A probably damaging Het
Dtx3l A G 16: 35,938,757 S41P possibly damaging Het
Eef1b2 G A 1: 63,179,457 probably null Het
Eml3 C T 19: 8,936,308 T43I probably damaging Het
Fam110b T A 4: 5,799,434 L284Q probably damaging Het
Gm5538 G A 3: 59,751,893 E256K probably benign Het
Gpr33 A C 12: 52,023,469 H262Q probably damaging Het
Igfals T G 17: 24,880,481 L182R probably damaging Het
Lamc1 A G 1: 153,250,459 F496L possibly damaging Het
Mgea5 G A 19: 45,752,155 R914* probably null Het
Muc4 T A 16: 32,750,525 H134Q possibly damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nxn A T 11: 76,274,069 C205* probably null Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Olfr651 C A 7: 104,553,086 H56N possibly damaging Het
Pamr1 A T 2: 102,639,353 I415F possibly damaging Het
Ppp4r4 G A 12: 103,579,068 G200E probably damaging Het
Prdm16 C A 4: 154,528,799 S57I probably damaging Het
Psmd11 A G 11: 80,471,584 K157R possibly damaging Het
Ptprn2 G A 12: 117,212,008 probably null Het
Pus7 G A 5: 23,768,795 H234Y probably benign Het
Rd3l A G 12: 111,980,283 Y20H probably benign Het
Stk31 A G 6: 49,409,207 D160G probably damaging Het
Sycp2 C T 2: 178,374,366 E768K possibly damaging Het
Tango6 T C 8: 106,688,895 V116A probably benign Het
Ttn C T 2: 76,867,230 probably benign Het
Xylb T C 9: 119,383,377 I427T probably damaging Het
Zc3h7a T G 16: 11,139,075 D890A probably damaging Het
Other mutations in Vmn2r114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Vmn2r114 APN 17 23291665 missense probably damaging 1.00
IGL00990:Vmn2r114 APN 17 23290965 missense probably benign
IGL00990:Vmn2r114 APN 17 23290983 missense probably benign 0.23
IGL00990:Vmn2r114 APN 17 23291238 missense probably damaging 1.00
IGL01838:Vmn2r114 APN 17 23296982 missense probably benign 0.44
IGL01990:Vmn2r114 APN 17 23310381 missense probably benign 0.22
IGL01994:Vmn2r114 APN 17 23310477 missense probably damaging 1.00
IGL02153:Vmn2r114 APN 17 23291808 missense probably benign 0.01
IGL02453:Vmn2r114 APN 17 23311134 missense probably benign 0.00
IGL02621:Vmn2r114 APN 17 23310520 missense probably damaging 0.98
IGL02938:Vmn2r114 APN 17 23291289 missense probably benign 0.10
IGL03130:Vmn2r114 APN 17 23296996 splice site probably benign
IGL03325:Vmn2r114 APN 17 23291678 missense probably damaging 1.00
R0109:Vmn2r114 UTSW 17 23310575 nonsense probably null
R0164:Vmn2r114 UTSW 17 23309826 critical splice donor site probably null
R0310:Vmn2r114 UTSW 17 23290943 missense probably benign 0.23
R0583:Vmn2r114 UTSW 17 23290932 makesense probably null
R0677:Vmn2r114 UTSW 17 23310594 missense probably damaging 1.00
R1147:Vmn2r114 UTSW 17 23311063 missense probably benign 0.00
R1147:Vmn2r114 UTSW 17 23311063 missense probably benign 0.00
R1157:Vmn2r114 UTSW 17 23310340 missense possibly damaging 0.60
R1323:Vmn2r114 UTSW 17 23290932 makesense probably null
R1347:Vmn2r114 UTSW 17 23290932 makesense probably null
R1435:Vmn2r114 UTSW 17 23290932 makesense probably null
R1437:Vmn2r114 UTSW 17 23291211 missense probably damaging 1.00
R1585:Vmn2r114 UTSW 17 23291701 missense probably damaging 0.98
R1641:Vmn2r114 UTSW 17 23296988 missense probably benign 0.00
R1748:Vmn2r114 UTSW 17 23308061 missense probably benign 0.17
R1954:Vmn2r114 UTSW 17 23311112 missense probably benign 0.32
R2081:Vmn2r114 UTSW 17 23291109 missense possibly damaging 0.91
R2103:Vmn2r114 UTSW 17 23290932 makesense probably null
R2113:Vmn2r114 UTSW 17 23290932 makesense probably null
R2134:Vmn2r114 UTSW 17 23291763 missense probably damaging 1.00
R2149:Vmn2r114 UTSW 17 23290932 makesense probably null
R2424:Vmn2r114 UTSW 17 23296868 missense possibly damaging 0.90
R2847:Vmn2r114 UTSW 17 23290974 missense probably benign 0.00
R2848:Vmn2r114 UTSW 17 23290974 missense probably benign 0.00
R2893:Vmn2r114 UTSW 17 23290932 makesense probably null
R3017:Vmn2r114 UTSW 17 23290932 makesense probably null
R3018:Vmn2r114 UTSW 17 23290932 makesense probably null
R3019:Vmn2r114 UTSW 17 23290932 makesense probably null
R3020:Vmn2r114 UTSW 17 23290932 makesense probably null
R3021:Vmn2r114 UTSW 17 23290932 makesense probably null
R4628:Vmn2r114 UTSW 17 23290932 makesense probably null
R4668:Vmn2r114 UTSW 17 23310473 missense possibly damaging 0.83
R4840:Vmn2r114 UTSW 17 23291379 missense probably damaging 0.97
R4841:Vmn2r114 UTSW 17 23310362 missense probably benign 0.04
R4842:Vmn2r114 UTSW 17 23310362 missense probably benign 0.04
R4856:Vmn2r114 UTSW 17 23308034 missense probably benign 0.11
R4886:Vmn2r114 UTSW 17 23308034 missense probably benign 0.11
R4992:Vmn2r114 UTSW 17 23291791 missense probably benign 0.03
R5182:Vmn2r114 UTSW 17 23291658 missense probably damaging 0.96
R5223:Vmn2r114 UTSW 17 23290932 makesense probably null
R5405:Vmn2r114 UTSW 17 23290932 makesense probably null
R5449:Vmn2r114 UTSW 17 23290932 makesense probably null
R5615:Vmn2r114 UTSW 17 23290932 makesense probably null
R5834:Vmn2r114 UTSW 17 23310625 missense possibly damaging 0.90
R6150:Vmn2r114 UTSW 17 23291295 missense probably benign 0.03
R6277:Vmn2r114 UTSW 17 23290980 missense possibly damaging 0.93
R6403:Vmn2r114 UTSW 17 23309965 missense probably damaging 0.99
R6589:Vmn2r114 UTSW 17 23291668 missense probably damaging 1.00
R6613:Vmn2r114 UTSW 17 23310246 missense possibly damaging 0.82
R6747:Vmn2r114 UTSW 17 23309876 missense probably benign 0.00
R6837:Vmn2r114 UTSW 17 23310202 missense probably benign 0.10
R6911:Vmn2r114 UTSW 17 23291130 missense probably damaging 0.98
R6950:Vmn2r114 UTSW 17 23310163 missense probably benign 0.03
R7276:Vmn2r114 UTSW 17 23290960 missense probably damaging 0.97
R7482:Vmn2r114 UTSW 17 23291494 missense probably damaging 1.00
R7514:Vmn2r114 UTSW 17 23308061 missense probably null 0.96
R7523:Vmn2r114 UTSW 17 23310637 missense probably benign 0.01
R7563:Vmn2r114 UTSW 17 23291026 missense probably benign 0.01
R7585:Vmn2r114 UTSW 17 23291265 missense probably damaging 1.00
R7593:Vmn2r114 UTSW 17 23291843 nonsense probably null
R7611:Vmn2r114 UTSW 17 23296970 missense probably damaging 0.97
R7641:Vmn2r114 UTSW 17 23308203 missense possibly damaging 0.53
R7651:Vmn2r114 UTSW 17 23291012 nonsense probably null
X0065:Vmn2r114 UTSW 17 23310957 missense probably benign 0.34
Z1088:Vmn2r114 UTSW 17 23290932 makesense probably null
Predicted Primers PCR Primer
(F):5'- ACGAGAATATTGAAAAGCAGACTCCCAG -3'
(R):5'- TGTTTACCATAGCACCAAAGGCAGG -3'

Sequencing Primer
(F):5'- gcaacccaaaaaagagcatctg -3'
(R):5'- CAAAGGCAGGGTCATGGTG -3'
Posted On2014-01-05