Incidental Mutation 'R1016:Fbxo40'
ID96358
Institutional Source Beutler Lab
Gene Symbol Fbxo40
Ensembl Gene ENSMUSG00000047746
Gene NameF-box protein 40
Synonyms
MMRRC Submission 039120-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R1016 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location36963460-36990467 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 36969177 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 524 (Q524*)
Ref Sequence ENSEMBL: ENSMUSP00000110454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075869] [ENSMUST00000114806]
Predicted Effect probably null
Transcript: ENSMUST00000075869
AA Change: Q524*
SMART Domains Protein: ENSMUSP00000075266
Gene: ENSMUSG00000047746
AA Change: Q524*

DomainStartEndE-ValueType
Pfam:zf-TRAF_2 12 104 6.1e-42 PFAM
Pfam:F-box_4 571 686 1.2e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114806
AA Change: Q524*
SMART Domains Protein: ENSMUSP00000110454
Gene: ENSMUSG00000047746
AA Change: Q524*

DomainStartEndE-ValueType
PDB:2YRE|A 12 92 1e-27 PDB
SCOP:d1k2fa_ 62 97 5e-4 SMART
Blast:FBOX 578 616 1e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132511
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.6%
  • 20x: 84.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXO40, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ceacam20 T A 7: 19,976,302 H6Q probably null Het
Clstn1 T C 4: 149,646,829 I866T probably benign Het
Cntnap1 T C 11: 101,177,507 V86A probably damaging Het
Crtc1 A T 8: 70,392,119 Y351* probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cyp2j12 C T 4: 96,112,865 probably null Het
Dmrt2 A T 19: 25,675,574 K183N probably damaging Het
Fancl G T 11: 26,387,195 probably benign Het
Flcn T C 11: 59,795,865 probably null Het
Gm19965 T A 1: 116,821,301 C237* probably null Het
Hpf1 A G 8: 60,895,644 Y131C possibly damaging Het
Mdh1 A G 11: 21,559,769 L202P probably benign Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mtus1 A G 8: 41,050,026 V784A probably benign Het
Myg1 T C 15: 102,334,351 I159T possibly damaging Het
Nans T C 4: 46,500,716 Y203H probably benign Het
Ncapg2 G A 12: 116,438,675 C709Y probably damaging Het
Olfr883 T C 9: 38,026,691 V295A probably damaging Het
Parp12 T C 6: 39,111,726 Y192C probably damaging Het
Plekha6 A G 1: 133,260,094 N118D probably benign Het
Prg4 T C 1: 150,454,691 probably benign Het
Psip1 T C 4: 83,459,898 T454A possibly damaging Het
Ptprz1 T C 6: 23,000,974 L1021P probably damaging Het
Pvr T C 7: 19,909,217 I364V probably benign Het
Serpina5 A G 12: 104,105,323 I396M probably damaging Het
Sgcb A C 5: 73,639,840 H192Q probably benign Het
Slc4a9 C A 18: 36,531,425 H379N probably benign Het
Tet1 T C 10: 62,879,950 D22G probably benign Het
Trim34a T C 7: 104,247,960 V77A probably benign Het
Ttc7b T C 12: 100,403,358 E384G probably null Het
Vmn2r16 G A 5: 109,339,888 G209D probably damaging Het
Other mutations in Fbxo40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Fbxo40 APN 16 36970454 missense probably damaging 1.00
IGL02238:Fbxo40 APN 16 36969174 missense possibly damaging 0.63
IGL02389:Fbxo40 APN 16 36969774 missense probably benign 0.26
IGL02619:Fbxo40 APN 16 36970404 missense possibly damaging 0.92
IGL02620:Fbxo40 APN 16 36966080 missense probably benign 0.14
R0532:Fbxo40 UTSW 16 36969622 missense possibly damaging 0.92
R1783:Fbxo40 UTSW 16 36966222 missense probably damaging 0.99
R1832:Fbxo40 UTSW 16 36968856 nonsense probably null
R1938:Fbxo40 UTSW 16 36969351 missense probably damaging 0.98
R1974:Fbxo40 UTSW 16 36969941 missense probably benign
R1995:Fbxo40 UTSW 16 36969869 missense probably damaging 1.00
R3856:Fbxo40 UTSW 16 36969083 missense probably damaging 1.00
R4346:Fbxo40 UTSW 16 36970163 missense probably benign 0.01
R4907:Fbxo40 UTSW 16 36969702 missense probably benign 0.01
R5059:Fbxo40 UTSW 16 36970296 missense possibly damaging 0.48
R5114:Fbxo40 UTSW 16 36968874 missense probably damaging 1.00
R5361:Fbxo40 UTSW 16 36969552 missense possibly damaging 0.62
R5721:Fbxo40 UTSW 16 36968934 missense probably benign 0.06
R5724:Fbxo40 UTSW 16 36970330 missense probably benign 0.18
R5808:Fbxo40 UTSW 16 36970382 missense probably damaging 1.00
R6189:Fbxo40 UTSW 16 36966164 missense probably benign 0.32
R6461:Fbxo40 UTSW 16 36970028 missense probably benign 0.00
R6571:Fbxo40 UTSW 16 36969306 missense probably damaging 1.00
R6598:Fbxo40 UTSW 16 36969014 missense probably damaging 1.00
R6639:Fbxo40 UTSW 16 36970575 missense probably damaging 1.00
R7017:Fbxo40 UTSW 16 36970370 missense probably damaging 1.00
R7827:Fbxo40 UTSW 16 36969499 missense probably damaging 1.00
R7889:Fbxo40 UTSW 16 36969650 missense probably damaging 1.00
R7972:Fbxo40 UTSW 16 36969650 missense probably damaging 1.00
R8047:Fbxo40 UTSW 16 36969869 missense not run
X0022:Fbxo40 UTSW 16 36969301 missense probably benign 0.37
Z1176:Fbxo40 UTSW 16 36969599 missense not run
Z1177:Fbxo40 UTSW 16 36970262 missense not run
Predicted Primers PCR Primer
(F):5'- AAGTGGCACAGATGTTCCTCATCAG -3'
(R):5'- AGCAGCTCAGCTTTTACGTTCACC -3'

Sequencing Primer
(F):5'- TGTATTGCAACACCTCCAGGG -3'
(R):5'- TTACGTTCACCTGCAACAAATTC -3'
Posted On2014-01-05