Incidental Mutation 'R1127:Igfals'
ID96359
Institutional Source Beutler Lab
Gene Symbol Igfals
Ensembl Gene ENSMUSG00000046070
Gene Nameinsulin-like growth factor binding protein, acid labile subunit
SynonymsALS, Albs
MMRRC Submission 039200-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1127 (G1)
Quality Score112
Status Not validated
Chromosome17
Chromosomal Location24878770-24882008 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 24880481 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 182 (L182R)
Ref Sequence ENSEMBL: ENSMUSP00000060169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044252] [ENSMUST00000050714]
Predicted Effect probably benign
Transcript: ENSMUST00000044252
SMART Domains Protein: ENSMUSP00000049319
Gene: ENSMUSG00000039183

DomainStartEndE-ValueType
Pfam:ParA 16 267 3.2e-99 PFAM
Pfam:ArsA_ATPase 19 66 1.7e-8 PFAM
Pfam:AAA_31 19 79 1.5e-8 PFAM
Pfam:MipZ 19 155 2.1e-10 PFAM
Pfam:CbiA 21 199 2.2e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000050714
AA Change: L182R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060169
Gene: ENSMUSG00000046070
AA Change: L182R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 40 78 9.37e-10 SMART
LRR 77 96 1.62e1 SMART
LRR 97 120 1.41e1 SMART
LRR_TYP 121 144 6.78e-3 SMART
LRR 145 168 1.03e1 SMART
LRR_TYP 169 192 1.1e-2 SMART
LRR 193 216 2.17e-1 SMART
LRR_TYP 217 240 2.4e-3 SMART
LRR_TYP 241 264 1.82e-3 SMART
LRR 265 288 5.72e-1 SMART
LRR_TYP 289 312 6.23e-2 SMART
LRR_TYP 313 336 6.32e-3 SMART
LRR_TYP 337 360 2.2e-2 SMART
LRR 361 384 1.89e-1 SMART
LRR 385 408 3.87e1 SMART
LRR 409 432 2.67e-1 SMART
LRR_TYP 433 456 1.06e-4 SMART
LRR_TYP 457 480 6.78e-3 SMART
LRR 481 504 1.09e2 SMART
LRR 505 530 2.68e1 SMART
LRRCT 535 582 5.11e-8 SMART
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 80.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serum protein that binds insulin-like growth factors, increasing their half-life and their vascular localization. Production of the encoded protein, which contains twenty leucine-rich repeats, is stimulated by growth hormone. Defects in this gene are a cause of acid-labile subunit deficiency, which maifests itself in a delayed and slow puberty. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene gain weight more slowly after birth and display less growth in long bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,135,203 D179G probably benign Het
Adh7 C T 3: 138,221,729 A12V probably benign Het
Ankhd1 T A 18: 36,634,346 N1179K probably damaging Het
Ankrd50 T C 3: 38,457,187 T344A probably benign Het
Aplf T C 6: 87,646,291 T269A probably benign Het
C87977 G A 4: 144,207,124 T471I probably damaging Het
Cavin4 T C 4: 48,663,637 S6P probably damaging Het
Ces2g T C 8: 104,967,462 probably null Het
Cyp2c66 A T 19: 39,163,368 N176Y probably damaging Het
Dnah3 T A 7: 119,923,030 D3980V probably damaging Het
Drc7 G T 8: 95,072,788 E530D probably damaging Het
Dst A G 1: 34,275,277 T6434A probably damaging Het
Dtx3l A G 16: 35,938,757 S41P possibly damaging Het
Eef1b2 G A 1: 63,179,457 probably null Het
Eml3 C T 19: 8,936,308 T43I probably damaging Het
Fam110b T A 4: 5,799,434 L284Q probably damaging Het
Gm5538 G A 3: 59,751,893 E256K probably benign Het
Gpr33 A C 12: 52,023,469 H262Q probably damaging Het
Lamc1 A G 1: 153,250,459 F496L possibly damaging Het
Mgea5 G A 19: 45,752,155 R914* probably null Het
Muc4 T A 16: 32,750,525 H134Q possibly damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nxn A T 11: 76,274,069 C205* probably null Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Olfr651 C A 7: 104,553,086 H56N possibly damaging Het
Pamr1 A T 2: 102,639,353 I415F possibly damaging Het
Ppp4r4 G A 12: 103,579,068 G200E probably damaging Het
Prdm16 C A 4: 154,528,799 S57I probably damaging Het
Psmd11 A G 11: 80,471,584 K157R possibly damaging Het
Ptprn2 G A 12: 117,212,008 probably null Het
Pus7 G A 5: 23,768,795 H234Y probably benign Het
Rd3l A G 12: 111,980,283 Y20H probably benign Het
Stk31 A G 6: 49,409,207 D160G probably damaging Het
Sycp2 C T 2: 178,374,366 E768K possibly damaging Het
Tango6 T C 8: 106,688,895 V116A probably benign Het
Ttn C T 2: 76,867,230 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Xylb T C 9: 119,383,377 I427T probably damaging Het
Zc3h7a T G 16: 11,139,075 D890A probably damaging Het
Other mutations in Igfals
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Igfals APN 17 24881660 missense probably benign 0.08
IGL01796:Igfals APN 17 24880082 missense probably damaging 0.96
IGL02448:Igfals APN 17 24880187 missense probably damaging 1.00
R1022:Igfals UTSW 17 24880483 missense probably damaging 0.99
R1024:Igfals UTSW 17 24880483 missense probably damaging 0.99
R1653:Igfals UTSW 17 24881078 missense probably benign 0.00
R1827:Igfals UTSW 17 24880304 missense probably benign 0.20
R3872:Igfals UTSW 17 24881605 missense possibly damaging 0.88
R3873:Igfals UTSW 17 24881605 missense possibly damaging 0.88
R3874:Igfals UTSW 17 24881605 missense possibly damaging 0.88
R4278:Igfals UTSW 17 24881217 missense probably benign 0.01
R5360:Igfals UTSW 17 24880093 missense probably benign 0.00
R5417:Igfals UTSW 17 24880316 missense probably damaging 1.00
R5654:Igfals UTSW 17 24881465 missense probably benign 0.23
R6261:Igfals UTSW 17 24881365 missense possibly damaging 0.88
R7061:Igfals UTSW 17 24880307 missense probably damaging 1.00
R7223:Igfals UTSW 17 24881234 missense probably damaging 1.00
R7484:Igfals UTSW 17 24879988 missense possibly damaging 0.95
R7699:Igfals UTSW 17 24880574 missense probably damaging 1.00
R7700:Igfals UTSW 17 24880574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCATCTGCACCTGGAACGGAAC -3'
(R):5'- TTGTGTGACAGGTCCAGCCAAC -3'

Sequencing Primer
(F):5'- CTGGAACGGAACCTGCTC -3'
(R):5'- AACGCAGTGCCTTCATGC -3'
Posted On2014-01-05