Incidental Mutation 'R1127:Cyp2c66'
ID96365
Institutional Source Beutler Lab
Gene Symbol Cyp2c66
Ensembl Gene ENSMUSG00000067229
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 66
Synonyms
MMRRC Submission 039200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R1127 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location39113898-39187072 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39163368 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 176 (N176Y)
Ref Sequence ENSEMBL: ENSMUSP00000084487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087234] [ENSMUST00000146494]
Predicted Effect probably damaging
Transcript: ENSMUST00000087234
AA Change: N176Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084487
Gene: ENSMUSG00000067229
AA Change: N176Y

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 1e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146494
SMART Domains Protein: ENSMUSP00000120397
Gene: ENSMUSG00000067229

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCOP:d1cpt__ 26 55 4e-9 SMART
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 80.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,135,203 D179G probably benign Het
Adh7 C T 3: 138,221,729 A12V probably benign Het
Ankhd1 T A 18: 36,634,346 N1179K probably damaging Het
Ankrd50 T C 3: 38,457,187 T344A probably benign Het
Aplf T C 6: 87,646,291 T269A probably benign Het
C87977 G A 4: 144,207,124 T471I probably damaging Het
Cavin4 T C 4: 48,663,637 S6P probably damaging Het
Ces2g T C 8: 104,967,462 probably null Het
Dnah3 T A 7: 119,923,030 D3980V probably damaging Het
Drc7 G T 8: 95,072,788 E530D probably damaging Het
Dst A G 1: 34,275,277 T6434A probably damaging Het
Dtx3l A G 16: 35,938,757 S41P possibly damaging Het
Eef1b2 G A 1: 63,179,457 probably null Het
Eml3 C T 19: 8,936,308 T43I probably damaging Het
Fam110b T A 4: 5,799,434 L284Q probably damaging Het
Gm5538 G A 3: 59,751,893 E256K probably benign Het
Gpr33 A C 12: 52,023,469 H262Q probably damaging Het
Igfals T G 17: 24,880,481 L182R probably damaging Het
Lamc1 A G 1: 153,250,459 F496L possibly damaging Het
Mgea5 G A 19: 45,752,155 R914* probably null Het
Muc4 T A 16: 32,750,525 H134Q possibly damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nxn A T 11: 76,274,069 C205* probably null Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Olfr651 C A 7: 104,553,086 H56N possibly damaging Het
Pamr1 A T 2: 102,639,353 I415F possibly damaging Het
Ppp4r4 G A 12: 103,579,068 G200E probably damaging Het
Prdm16 C A 4: 154,528,799 S57I probably damaging Het
Psmd11 A G 11: 80,471,584 K157R possibly damaging Het
Ptprn2 G A 12: 117,212,008 probably null Het
Pus7 G A 5: 23,768,795 H234Y probably benign Het
Rd3l A G 12: 111,980,283 Y20H probably benign Het
Stk31 A G 6: 49,409,207 D160G probably damaging Het
Sycp2 C T 2: 178,374,366 E768K possibly damaging Het
Tango6 T C 8: 106,688,895 V116A probably benign Het
Ttn C T 2: 76,867,230 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Xylb T C 9: 119,383,377 I427T probably damaging Het
Zc3h7a T G 16: 11,139,075 D890A probably damaging Het
Other mutations in Cyp2c66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01145:Cyp2c66 APN 19 39170961 missense probably benign 0.00
IGL01589:Cyp2c66 APN 19 39183935 critical splice donor site probably null
IGL02098:Cyp2c66 APN 19 39171029 missense probably damaging 1.00
IGL02114:Cyp2c66 APN 19 39171075 splice site probably benign
IGL02567:Cyp2c66 APN 19 39186640 utr 3 prime probably benign
IGL03181:Cyp2c66 APN 19 39142039 missense probably benign 0.00
IGL03230:Cyp2c66 APN 19 39183858 missense possibly damaging 0.91
R0007:Cyp2c66 UTSW 19 39170958 nonsense probably null
R0092:Cyp2c66 UTSW 19 39183780 splice site probably benign
R0242:Cyp2c66 UTSW 19 39141925 missense probably damaging 1.00
R0242:Cyp2c66 UTSW 19 39141925 missense probably damaging 1.00
R0324:Cyp2c66 UTSW 19 39176691 missense probably benign 0.27
R0675:Cyp2c66 UTSW 19 39186616 missense possibly damaging 0.93
R1871:Cyp2c66 UTSW 19 39163414 missense possibly damaging 0.66
R3404:Cyp2c66 UTSW 19 39163327 missense probably benign
R3429:Cyp2c66 UTSW 19 39163448 missense probably damaging 0.97
R3896:Cyp2c66 UTSW 19 39142278 missense possibly damaging 0.82
R4115:Cyp2c66 UTSW 19 39176559 missense possibly damaging 0.66
R4116:Cyp2c66 UTSW 19 39176559 missense possibly damaging 0.66
R4667:Cyp2c66 UTSW 19 39176656 missense probably damaging 1.00
R4668:Cyp2c66 UTSW 19 39176656 missense probably damaging 1.00
R4711:Cyp2c66 UTSW 19 39163399 missense possibly damaging 0.74
R4960:Cyp2c66 UTSW 19 39163322 critical splice acceptor site probably null
R5070:Cyp2c66 UTSW 19 39163470 missense probably benign 0.15
R5113:Cyp2c66 UTSW 19 39163438 missense probably benign 0.00
R5125:Cyp2c66 UTSW 19 39171029 missense probably damaging 1.00
R5178:Cyp2c66 UTSW 19 39171029 missense probably damaging 1.00
R5588:Cyp2c66 UTSW 19 39163414 missense possibly damaging 0.66
R6011:Cyp2c66 UTSW 19 39141936 missense probably benign 0.00
R6497:Cyp2c66 UTSW 19 39163377 missense probably damaging 0.96
R6707:Cyp2c66 UTSW 19 39186500 missense probably damaging 1.00
R7173:Cyp2c66 UTSW 19 39170957 missense probably benign 0.01
R7202:Cyp2c66 UTSW 19 39141904 missense probably damaging 1.00
R7469:Cyp2c66 UTSW 19 39183863 missense probably damaging 1.00
R7614:Cyp2c66 UTSW 19 39171028 missense probably damaging 0.98
R8012:Cyp2c66 UTSW 19 39183925 missense probably damaging 1.00
R8056:Cyp2c66 UTSW 19 39142041 missense probably benign 0.00
Z1177:Cyp2c66 UTSW 19 39186626 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGCAAGACTTGCTTAAATTGTGACCAG -3'
(R):5'- CCTTGTGGCTAACAGGTGTCAACAATG -3'

Sequencing Primer
(F):5'- TGACCAGTTTCTTTATCTGTTGAG -3'
(R):5'- caagaagtgggagtgagtagg -3'
Posted On2014-01-05