Incidental Mutation 'R1128:Akp3'
ID 96371
Institutional Source Beutler Lab
Gene Symbol Akp3
Ensembl Gene ENSMUSG00000036500
Gene Name alkaline phosphatase 3, intestine, not Mn requiring
Synonyms IAP, Akp-3
MMRRC Submission 039201-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.217) question?
Stock # R1128 (G1)
Quality Score 162
Status Not validated
Chromosome 1
Chromosomal Location 87052695-87055634 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 87055593 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 547 (G547R)
Ref Sequence ENSEMBL: ENSMUSP00000037497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044878]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000044878
AA Change: G547R
SMART Domains Protein: ENSMUSP00000037497
Gene: ENSMUSG00000036500
AA Change: G547R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 33 45 N/A INTRINSIC
alkPPc 53 487 1.92e-249 SMART
low complexity region 503 524 N/A INTRINSIC
low complexity region 533 557 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187662
Meta Mutation Damage Score 0.0693 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The intestinal alkaline phosphatase gene encodes a digestive brush-border enzyme. This enzyme is a component of the gut mucosal defense system and is thought to function in the detoxification of lipopolysaccharide, and in the prevention of bacterial translocation in the gut. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruption of this gene show no gross abnormalities in appearance, behavior or fertility. They do display accelerated lipid absorption on a high fat diet leading to elevated plasma triglycerides and increased weight gain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amhr2 A T 15: 102,361,256 (GRCm39) Q402L probably benign Het
Brip1 A T 11: 85,955,763 (GRCm39) L917M possibly damaging Het
Dennd5a G A 7: 109,520,541 (GRCm39) R415* probably null Het
Eif2ak1 G T 5: 143,835,994 (GRCm39) probably null Het
Golga4 G A 9: 118,377,852 (GRCm39) A458T probably benign Het
H1f6 G T 13: 23,880,307 (GRCm39) K153N possibly damaging Het
Ift88 C T 14: 57,754,476 (GRCm39) R762* probably null Het
Kansl2 A T 15: 98,431,566 (GRCm39) C28* probably null Het
Lct T C 1: 128,229,046 (GRCm39) R816G probably damaging Het
Mzf1 C A 7: 12,786,698 (GRCm39) R124L possibly damaging Het
Obscn T C 11: 58,919,769 (GRCm39) N6809S probably null Het
Pak6 A G 2: 118,526,990 (GRCm39) T662A probably benign Het
Pglyrp3 T C 3: 91,935,479 (GRCm39) F243S probably benign Het
Rab44 T C 17: 29,359,435 (GRCm39) V541A possibly damaging Het
Slc39a6 G T 18: 24,718,349 (GRCm39) H569Q probably damaging Het
Slc4a7 T C 14: 14,733,832 (GRCm38) S87P probably damaging Het
Spocd1 T C 4: 129,850,599 (GRCm39) V875A possibly damaging Het
Tspan17 A G 13: 54,942,984 (GRCm39) D146G probably damaging Het
Other mutations in Akp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Akp3 APN 1 87,054,858 (GRCm39) splice site probably benign
IGL02146:Akp3 APN 1 87,054,297 (GRCm39) missense probably benign 0.00
IGL02216:Akp3 APN 1 87,055,372 (GRCm39) missense probably damaging 1.00
IGL02677:Akp3 APN 1 87,052,994 (GRCm39) missense probably damaging 1.00
IGL02716:Akp3 APN 1 87,053,201 (GRCm39) missense probably damaging 1.00
IGL02943:Akp3 APN 1 87,054,091 (GRCm39) nonsense probably null
IGL03099:Akp3 APN 1 87,055,328 (GRCm39) missense probably benign 0.14
R0458:Akp3 UTSW 1 87,054,259 (GRCm39) nonsense probably null
R0755:Akp3 UTSW 1 87,055,593 (GRCm39) missense unknown
R0783:Akp3 UTSW 1 87,055,593 (GRCm39) missense unknown
R0784:Akp3 UTSW 1 87,055,593 (GRCm39) missense unknown
R1080:Akp3 UTSW 1 87,054,723 (GRCm39) missense probably damaging 0.99
R1120:Akp3 UTSW 1 87,053,159 (GRCm39) missense probably damaging 0.98
R1130:Akp3 UTSW 1 87,055,593 (GRCm39) missense unknown
R1175:Akp3 UTSW 1 87,055,593 (GRCm39) missense unknown
R1200:Akp3 UTSW 1 87,052,982 (GRCm39) missense probably damaging 1.00
R1618:Akp3 UTSW 1 87,055,593 (GRCm39) missense unknown
R1864:Akp3 UTSW 1 87,055,489 (GRCm39) small deletion probably benign
R2111:Akp3 UTSW 1 87,054,607 (GRCm39) splice site probably null
R4657:Akp3 UTSW 1 87,053,556 (GRCm39) intron probably benign
R5278:Akp3 UTSW 1 87,052,888 (GRCm39) missense probably benign 0.01
R5563:Akp3 UTSW 1 87,053,646 (GRCm39) missense probably damaging 1.00
R5643:Akp3 UTSW 1 87,055,485 (GRCm39) missense unknown
R5768:Akp3 UTSW 1 87,054,844 (GRCm39) missense probably damaging 0.99
R5809:Akp3 UTSW 1 87,054,270 (GRCm39) missense probably benign 0.06
R5956:Akp3 UTSW 1 87,054,667 (GRCm39) missense probably damaging 1.00
R5999:Akp3 UTSW 1 87,055,263 (GRCm39) missense probably damaging 1.00
R6945:Akp3 UTSW 1 87,053,353 (GRCm39) missense probably damaging 1.00
R7028:Akp3 UTSW 1 87,054,500 (GRCm39) missense probably benign
R7154:Akp3 UTSW 1 87,052,946 (GRCm39) missense probably damaging 0.99
R7162:Akp3 UTSW 1 87,055,471 (GRCm39) missense unknown
R7486:Akp3 UTSW 1 87,053,201 (GRCm39) missense probably damaging 1.00
R7825:Akp3 UTSW 1 87,055,489 (GRCm39) small deletion probably benign
R8267:Akp3 UTSW 1 87,055,461 (GRCm39) missense unknown
R8708:Akp3 UTSW 1 87,054,091 (GRCm39) nonsense probably null
R9026:Akp3 UTSW 1 87,054,786 (GRCm39) missense possibly damaging 0.89
R9433:Akp3 UTSW 1 87,053,517 (GRCm39) missense probably benign 0.01
X0018:Akp3 UTSW 1 87,054,060 (GRCm39) missense probably damaging 1.00
X0060:Akp3 UTSW 1 87,053,616 (GRCm39) missense probably damaging 1.00
X0066:Akp3 UTSW 1 87,054,518 (GRCm39) missense probably damaging 0.98
Z1177:Akp3 UTSW 1 87,054,167 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCAGGAGCAGAACTACATCGC -3'
(R):5'- CTGCAATGCAAGGTAGGGCTAGAC -3'

Sequencing Primer
(F):5'- GAACTACATCGCGCACGTC -3'
(R):5'- CTAGACATGAGGCCAGTAGC -3'
Posted On 2014-01-05