Incidental Mutation 'R1128:Pglyrp3'
ID96381
Institutional Source Beutler Lab
Gene Symbol Pglyrp3
Ensembl Gene ENSMUSG00000042244
Gene Namepeptidoglycan recognition protein 3
SynonymsLOC242100
MMRRC Submission 039201-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R1128 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location92014583-92031582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92028172 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 243 (F243S)
Ref Sequence ENSEMBL: ENSMUSP00000035737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047660]
Predicted Effect probably benign
Transcript: ENSMUST00000047660
AA Change: F243S

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000035737
Gene: ENSMUSG00000042244
AA Change: F243S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PGRP 28 169 2.64e-45 SMART
Ami_2 39 169 1.06e-2 SMART
PGRP 185 326 3.23e-72 SMART
Ami_2 195 332 1.75e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118636
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peptidoglycan recognition protein, which belongs to the N-acetylmuramoyl-L-alanine amidase 2 family. These proteins are part of the innate immune system and recognize peptidoglycan, a ubiquitous component of bacterial cell walls. This antimicrobial protein binds to murein peptidoglycans of Gram-positive bacteria. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akp3 G A 1: 87,127,871 G547R unknown Het
Amhr2 A T 15: 102,452,821 Q402L probably benign Het
Brip1 A T 11: 86,064,937 L917M possibly damaging Het
Dennd5a G A 7: 109,921,334 R415* probably null Het
Eif2ak1 G T 5: 143,899,176 probably null Het
Golga4 G A 9: 118,548,784 A458T probably benign Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Ift88 C T 14: 57,517,019 R762* probably null Het
Kansl2 A T 15: 98,533,685 C28* probably null Het
Lct T C 1: 128,301,309 R816G probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Obscn T C 11: 59,028,943 N6809S probably null Het
Pak6 A G 2: 118,696,509 T662A probably benign Het
Rab44 T C 17: 29,140,461 V541A possibly damaging Het
Slc39a6 G T 18: 24,585,292 H569Q probably damaging Het
Slc4a7 T C 14: 14,733,832 S87P probably damaging Het
Spocd1 T C 4: 129,956,806 V875A possibly damaging Het
Tspan17 A G 13: 54,795,171 D146G probably damaging Het
Other mutations in Pglyrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Pglyrp3 APN 3 92022679 missense probably damaging 0.96
IGL00769:Pglyrp3 APN 3 92014622 utr 5 prime probably benign
IGL02491:Pglyrp3 APN 3 92014637 missense possibly damaging 0.77
IGL03279:Pglyrp3 APN 3 92026527 missense probably damaging 1.00
R0056:Pglyrp3 UTSW 3 92025804 splice site probably benign
R2097:Pglyrp3 UTSW 3 92028171 missense possibly damaging 0.91
R2140:Pglyrp3 UTSW 3 92026567 missense probably benign 0.00
R3697:Pglyrp3 UTSW 3 92028174 missense probably damaging 1.00
R4369:Pglyrp3 UTSW 3 92028079 missense probably damaging 1.00
R4430:Pglyrp3 UTSW 3 92031491 missense probably damaging 1.00
R4775:Pglyrp3 UTSW 3 92025730 missense possibly damaging 0.64
R6020:Pglyrp3 UTSW 3 92031534 missense probably damaging 1.00
R7352:Pglyrp3 UTSW 3 92014640 nonsense probably null
R7437:Pglyrp3 UTSW 3 92030678 missense probably benign 0.00
R8150:Pglyrp3 UTSW 3 92026483 missense probably benign 0.00
Z1176:Pglyrp3 UTSW 3 92028085 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAATATCACACCACGGTCTGCTTG -3'
(R):5'- AGGCATCATACTTCTTTGGGGTTCG -3'

Sequencing Primer
(F):5'- TCTGCTTGGGAAGCCAGAG -3'
(R):5'- GTGATGTTCCCAATCACAATGG -3'
Posted On2014-01-05