Incidental Mutation 'R1017:Olfr1065'
ID96386
Institutional Source Beutler Lab
Gene Symbol Olfr1065
Ensembl Gene ENSMUSG00000111306
Gene Nameolfactory receptor 1065
SynonymsMOR190-1, GA_x6K02T2Q125-47915274-47914333
MMRRC Submission 039121-MU
Accession Numbers

Genbank: NM_146408; MGI: 3030899

Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R1017 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86443958-86450591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86445428 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 185 (L185I)
Ref Sequence ENSEMBL: ENSMUSP00000149248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000213789] [ENSMUST00000216162] [ENSMUST00000216165] [ENSMUST00000217586]
Predicted Effect probably benign
Transcript: ENSMUST00000099886
AA Change: L185I

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097471
Gene: ENSMUSG00000075182
AA Change: L185I

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.1e-53 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213789
AA Change: L185I

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000216162
AA Change: L185I

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000216165
AA Change: L185I

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000217586
AA Change: L185I

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.1008 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp C T 6: 125,061,260 probably benign Het
Ahnak A T 19: 9,010,543 I3064F probably damaging Het
Arhgef10l C A 4: 140,515,306 R884L probably damaging Het
Baiap2l2 A G 15: 79,261,243 F317L probably benign Het
Brinp2 A T 1: 158,249,451 I358N probably damaging Het
Ccin A G 4: 43,985,222 D543G probably benign Het
Cdh23 T A 10: 60,331,793 D1806V probably damaging Het
Cdh6 C T 15: 13,051,476 R357Q probably benign Het
Cpa3 T C 3: 20,239,633 M64V possibly damaging Het
Ctnnb1 T A 9: 120,950,728 F74I probably damaging Het
Cyp7a1 A T 4: 6,272,307 I302N probably damaging Het
Dnase1l2 C T 17: 24,442,472 A56T probably benign Het
Dscam T A 16: 96,833,433 D190V probably damaging Het
Fer1l4 T C 2: 156,049,478 probably null Het
Fscb T A 12: 64,473,468 D408V probably benign Het
Gm10306 A G 4: 94,556,720 probably benign Het
Gon4l T A 3: 88,858,496 M409K probably benign Het
Gsx2 T C 5: 75,077,262 S292P probably damaging Het
Hira T A 16: 18,899,347 probably null Het
Hoxa3 G T 6: 52,172,406 probably null Het
Irak3 T C 10: 120,142,884 E554G possibly damaging Het
Itgb3bp A G 4: 99,769,487 probably benign Het
Kifc3 C T 8: 95,105,785 D379N probably damaging Het
Lama5 A G 2: 180,195,420 V1032A probably damaging Het
Lmln T G 16: 33,088,176 I324R probably benign Het
Ltbp4 A G 7: 27,306,076 S1547P possibly damaging Het
Mdga1 T A 17: 29,850,548 T175S probably damaging Het
Mrps6 T A 16: 92,058,458 L8* probably null Het
Mtmr11 A C 3: 96,164,477 T203P probably damaging Het
Nat8f7 T C 6: 85,707,570 D96G probably damaging Het
Obscn T C 11: 58,998,353 E7531G unknown Het
Olfr1061 A T 2: 86,413,511 D180E probably damaging Het
Olfr267 A T 4: 58,785,115 S202R probably damaging Het
Osbpl6 A G 2: 76,549,719 Y69C probably damaging Het
Polrmt C T 10: 79,743,509 W136* probably null Het
Raver1 T C 9: 21,079,590 probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rsl1d1 T C 16: 11,203,252 K2E probably benign Het
Sik3 C T 9: 46,195,809 T417I probably benign Het
Spdl1 T C 11: 34,819,290 K388R possibly damaging Het
Tulp1 T C 17: 28,364,303 R88G probably damaging Het
Vldlr A C 19: 27,241,333 Y528S probably damaging Het
Zdhhc14 T A 17: 5,493,649 L68H probably damaging Het
Zfp605 C T 5: 110,127,994 T326I probably benign Het
Other mutations in Olfr1065
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03133:Olfr1065 APN 2 86445658 missense probably damaging 0.99
IGL03173:Olfr1065 APN 2 86445444 nonsense probably null
IGL03257:Olfr1065 APN 2 86445890 missense probably damaging 0.98
D4043:Olfr1065 UTSW 2 86445220 missense probably damaging 0.99
R0265:Olfr1065 UTSW 2 86445959 missense probably benign 0.00
R0550:Olfr1065 UTSW 2 86445876 nonsense probably null
R0633:Olfr1065 UTSW 2 86445129 missense probably benign 0.45
R0727:Olfr1065 UTSW 2 86445938 missense probably benign 0.00
R1416:Olfr1065 UTSW 2 86445320 missense probably benign 0.43
R1657:Olfr1065 UTSW 2 86445218 missense probably damaging 1.00
R1983:Olfr1065 UTSW 2 86445076 missense probably benign 0.01
R3919:Olfr1065 UTSW 2 86445418 missense probably benign 0.01
R4345:Olfr1065 UTSW 2 86445845 missense probably damaging 1.00
R5382:Olfr1065 UTSW 2 86445316 missense probably damaging 0.99
R5757:Olfr1065 UTSW 2 86445578 missense probably benign 0.22
R6530:Olfr1065 UTSW 2 86445482 missense probably benign 0.31
R6765:Olfr1065 UTSW 2 86445236 missense probably benign 0.04
R6856:Olfr1065 UTSW 2 86445907 missense probably benign 0.04
R7156:Olfr1065 UTSW 2 86445308 missense probably damaging 1.00
R8239:Olfr1065 UTSW 2 86445129 missense noncoding transcript
R8338:Olfr1065 UTSW 2 86445385 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCCTCAGCAGAGTTCATCCTAAG -3'
(R):5'- AGACACCTCGCTACTACTGACCTTG -3'

Sequencing Primer
(F):5'- CAGCAGAGTTCATCCTAAGTATAGC -3'
(R):5'- GCAATGTCCTATGACCGCTATG -3'
Posted On2014-01-05