Incidental Mutation 'R1128:Eif2ak1'
ID96387
Institutional Source Beutler Lab
Gene Symbol Eif2ak1
Ensembl Gene ENSMUSG00000029613
Gene Nameeukaryotic translation initiation factor 2 alpha kinase 1
SynonymsHri
MMRRC Submission 039201-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R1128 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location143817788-143904251 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 143899176 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031613] [ENSMUST00000079624] [ENSMUST00000100483] [ENSMUST00000100487] [ENSMUST00000110717] [ENSMUST00000110718]
Predicted Effect probably benign
Transcript: ENSMUST00000031613
SMART Domains Protein: ENSMUSP00000031613
Gene: ENSMUSG00000029610

DomainStartEndE-ValueType
Pfam:AIMP2_LysRS_bd 1 44 8.3e-26 PFAM
low complexity region 133 142 N/A INTRINSIC
Pfam:GST_C_3 231 308 2.5e-10 PFAM
Pfam:GST_C 242 310 5e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000079624
SMART Domains Protein: ENSMUSP00000078571
Gene: ENSMUSG00000029607

DomainStartEndE-ValueType
ANK 36 61 2.55e2 SMART
ANK 65 118 8.5e2 SMART
ANK 124 153 1.27e-2 SMART
ANK 157 186 7.95e-4 SMART
ANK 191 230 3.74e0 SMART
ANK 234 263 3.46e-4 SMART
Blast:ANK 267 300 4e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000100483
SMART Domains Protein: ENSMUSP00000098052
Gene: ENSMUSG00000029610

DomainStartEndE-ValueType
low complexity region 93 102 N/A INTRINSIC
Pfam:GST_C_3 185 268 1.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100487
AA Change: G562W

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098056
Gene: ENSMUSG00000029613
AA Change: G562W

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 62 81 N/A INTRINSIC
Pfam:Pkinase_Tyr 167 242 5.6e-6 PFAM
Pfam:Pkinase 167 257 1.9e-15 PFAM
low complexity region 314 320 N/A INTRINSIC
Pfam:Pkinase 365 580 1.3e-31 PFAM
Pfam:Pkinase_Tyr 373 578 1.9e-19 PFAM
coiled coil region 585 619 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110717
SMART Domains Protein: ENSMUSP00000106345
Gene: ENSMUSG00000029607

DomainStartEndE-ValueType
Blast:ANK 28 57 6e-11 BLAST
ANK 78 103 1.6e0 SMART
ANK 107 160 5.6e0 SMART
ANK 166 195 8.4e-5 SMART
ANK 199 228 5.3e-6 SMART
ANK 233 272 2.4e-2 SMART
ANK 276 305 2.3e-6 SMART
Blast:ANK 309 342 5e-11 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000110718
SMART Domains Protein: ENSMUSP00000106346
Gene: ENSMUSG00000029607

DomainStartEndE-ValueType
ANK 35 60 2.55e2 SMART
ANK 64 117 8.5e2 SMART
ANK 123 152 1.27e-2 SMART
ANK 156 185 7.95e-4 SMART
ANK 190 229 3.74e0 SMART
ANK 233 262 3.46e-4 SMART
Blast:ANK 266 299 4e-11 BLAST
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts at the level of translation initiation to downregulate protein synthesis in response to stress. The encoded protein is a kinase that can be inactivated by hemin. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit enlarged heart size and abnormal red blood cell development, morphology, and physiology with macrocytic anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akp3 G A 1: 87,127,871 G547R unknown Het
Amhr2 A T 15: 102,452,821 Q402L probably benign Het
Brip1 A T 11: 86,064,937 L917M possibly damaging Het
Dennd5a G A 7: 109,921,334 R415* probably null Het
Golga4 G A 9: 118,548,784 A458T probably benign Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Ift88 C T 14: 57,517,019 R762* probably null Het
Kansl2 A T 15: 98,533,685 C28* probably null Het
Lct T C 1: 128,301,309 R816G probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Obscn T C 11: 59,028,943 N6809S probably null Het
Pak6 A G 2: 118,696,509 T662A probably benign Het
Pglyrp3 T C 3: 92,028,172 F243S probably benign Het
Rab44 T C 17: 29,140,461 V541A possibly damaging Het
Slc39a6 G T 18: 24,585,292 H569Q probably damaging Het
Slc4a7 T C 14: 14,733,832 S87P probably damaging Het
Spocd1 T C 4: 129,956,806 V875A possibly damaging Het
Tspan17 A G 13: 54,795,171 D146G probably damaging Het
Other mutations in Eif2ak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Eif2ak1 APN 5 143889470 missense probably damaging 0.99
IGL02170:Eif2ak1 APN 5 143879460 missense probably benign 0.01
IGL02472:Eif2ak1 APN 5 143884883 missense probably benign 0.00
IGL02898:Eif2ak1 APN 5 143889452 missense probably damaging 1.00
IGL03078:Eif2ak1 APN 5 143873769 missense probably benign 0.02
PIT4520001:Eif2ak1 UTSW 5 143899209 nonsense probably null
R0523:Eif2ak1 UTSW 5 143882166 missense probably damaging 1.00
R0755:Eif2ak1 UTSW 5 143884924 missense possibly damaging 0.94
R1203:Eif2ak1 UTSW 5 143883979 missense probably benign 0.00
R1445:Eif2ak1 UTSW 5 143873899 splice site probably benign
R1474:Eif2ak1 UTSW 5 143871967 missense probably damaging 1.00
R1972:Eif2ak1 UTSW 5 143884714 missense probably benign 0.04
R3885:Eif2ak1 UTSW 5 143884661 missense probably benign 0.21
R3889:Eif2ak1 UTSW 5 143884661 missense probably benign 0.21
R4754:Eif2ak1 UTSW 5 143901803 missense probably damaging 0.99
R4971:Eif2ak1 UTSW 5 143882168 missense probably damaging 1.00
R5007:Eif2ak1 UTSW 5 143873880 missense probably benign
R5487:Eif2ak1 UTSW 5 143897163 critical splice acceptor site probably null
R5505:Eif2ak1 UTSW 5 143817990 missense probably benign
R5808:Eif2ak1 UTSW 5 143883994 missense probably benign 0.21
R5888:Eif2ak1 UTSW 5 143886915 missense probably damaging 1.00
R6290:Eif2ak1 UTSW 5 143884799 missense probably benign 0.34
R6322:Eif2ak1 UTSW 5 143899095 missense probably benign 0.05
R6475:Eif2ak1 UTSW 5 143818010 splice site probably null
R7343:Eif2ak1 UTSW 5 143877671 missense probably damaging 1.00
R7525:Eif2ak1 UTSW 5 143886898 missense probably damaging 1.00
R7554:Eif2ak1 UTSW 5 143879478 missense probably damaging 1.00
R7659:Eif2ak1 UTSW 5 143889462 missense probably damaging 1.00
R8341:Eif2ak1 UTSW 5 143884937 missense probably benign 0.34
X0027:Eif2ak1 UTSW 5 143879435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCTCTGGGTATCAAAGGGATG -3'
(R):5'- AGTTCAAGTCTGCAATCCCAGCAC -3'

Sequencing Primer
(F):5'- GAGACTGTACTGTTAGACATGCCC -3'
(R):5'- attaataaaaCTATCATCGGGGTGGG -3'
Posted On2014-01-05