Incidental Mutation 'R1017:Fer1l4'
ID96392
Institutional Source Beutler Lab
Gene Symbol Fer1l4
Ensembl Gene ENSMUSG00000013338
Gene Namefer-1-like 4 (C. elegans)
Synonyms9130402C12Rik
MMRRC Submission 039121-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1017 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location156019139-156052947 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 156049478 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109611] [ENSMUST00000109611]
Predicted Effect probably null
Transcript: ENSMUST00000109611
SMART Domains Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338

DomainStartEndE-ValueType
PDB:3L9B|A 1 122 1e-12 PDB
Blast:C2 2 96 2e-51 BLAST
low complexity region 159 172 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
C2 228 329 2.87e-7 SMART
FerI 312 383 7.93e-29 SMART
C2 391 501 3.64e-9 SMART
low complexity region 574 581 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
low complexity region 844 855 N/A INTRINSIC
FerB 861 932 7.27e-37 SMART
C2 968 1076 3.73e-6 SMART
low complexity region 1249 1257 N/A INTRINSIC
low complexity region 1280 1310 N/A INTRINSIC
low complexity region 1327 1340 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
C2 1449 1548 5.65e-15 SMART
C2 1692 1822 4.22e-5 SMART
Pfam:Ferlin_C 1834 1987 1.6e-74 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109611
SMART Domains Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338

DomainStartEndE-ValueType
PDB:3L9B|A 1 122 1e-12 PDB
Blast:C2 2 96 2e-51 BLAST
low complexity region 159 172 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
C2 228 329 2.87e-7 SMART
FerI 312 383 7.93e-29 SMART
C2 391 501 3.64e-9 SMART
low complexity region 574 581 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
low complexity region 844 855 N/A INTRINSIC
FerB 861 932 7.27e-37 SMART
C2 968 1076 3.73e-6 SMART
low complexity region 1249 1257 N/A INTRINSIC
low complexity region 1280 1310 N/A INTRINSIC
low complexity region 1327 1340 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
C2 1449 1548 5.65e-15 SMART
C2 1692 1822 4.22e-5 SMART
Pfam:Ferlin_C 1834 1987 1.6e-74 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp C T 6: 125,061,260 probably benign Het
Ahnak A T 19: 9,010,543 I3064F probably damaging Het
Arhgef10l C A 4: 140,515,306 R884L probably damaging Het
Baiap2l2 A G 15: 79,261,243 F317L probably benign Het
Brinp2 A T 1: 158,249,451 I358N probably damaging Het
Ccin A G 4: 43,985,222 D543G probably benign Het
Cdh23 T A 10: 60,331,793 D1806V probably damaging Het
Cdh6 C T 15: 13,051,476 R357Q probably benign Het
Cpa3 T C 3: 20,239,633 M64V possibly damaging Het
Ctnnb1 T A 9: 120,950,728 F74I probably damaging Het
Cyp7a1 A T 4: 6,272,307 I302N probably damaging Het
Dnase1l2 C T 17: 24,442,472 A56T probably benign Het
Dscam T A 16: 96,833,433 D190V probably damaging Het
Fscb T A 12: 64,473,468 D408V probably benign Het
Gm10306 A G 4: 94,556,720 probably benign Het
Gon4l T A 3: 88,858,496 M409K probably benign Het
Gsx2 T C 5: 75,077,262 S292P probably damaging Het
Hira T A 16: 18,899,347 probably null Het
Hoxa3 G T 6: 52,172,406 probably null Het
Irak3 T C 10: 120,142,884 E554G possibly damaging Het
Itgb3bp A G 4: 99,769,487 probably benign Het
Kifc3 C T 8: 95,105,785 D379N probably damaging Het
Lama5 A G 2: 180,195,420 V1032A probably damaging Het
Lmln T G 16: 33,088,176 I324R probably benign Het
Ltbp4 A G 7: 27,306,076 S1547P possibly damaging Het
Mdga1 T A 17: 29,850,548 T175S probably damaging Het
Mrps6 T A 16: 92,058,458 L8* probably null Het
Mtmr11 A C 3: 96,164,477 T203P probably damaging Het
Nat8f7 T C 6: 85,707,570 D96G probably damaging Het
Obscn T C 11: 58,998,353 E7531G unknown Het
Olfr1061 A T 2: 86,413,511 D180E probably damaging Het
Olfr1065 A T 2: 86,445,428 L185I probably benign Het
Olfr267 A T 4: 58,785,115 S202R probably damaging Het
Osbpl6 A G 2: 76,549,719 Y69C probably damaging Het
Polrmt C T 10: 79,743,509 W136* probably null Het
Raver1 T C 9: 21,079,590 probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rsl1d1 T C 16: 11,203,252 K2E probably benign Het
Sik3 C T 9: 46,195,809 T417I probably benign Het
Spdl1 T C 11: 34,819,290 K388R possibly damaging Het
Tulp1 T C 17: 28,364,303 R88G probably damaging Het
Vldlr A C 19: 27,241,333 Y528S probably damaging Het
Zdhhc14 T A 17: 5,493,649 L68H probably damaging Het
Zfp605 C T 5: 110,127,994 T326I probably benign Het
Other mutations in Fer1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fer1l4 APN 2 156019920 nonsense probably null
IGL01025:Fer1l4 APN 2 156052185 missense probably benign 0.41
IGL01103:Fer1l4 APN 2 156044441 critical splice donor site probably null
IGL01322:Fer1l4 APN 2 156020339 splice site probably null
IGL01391:Fer1l4 APN 2 156036456 missense probably damaging 1.00
IGL02176:Fer1l4 APN 2 156048451 missense probably benign
IGL02267:Fer1l4 APN 2 156031252 missense possibly damaging 0.60
IGL02291:Fer1l4 APN 2 156019538 missense probably damaging 1.00
IGL02385:Fer1l4 APN 2 156045428 missense probably benign 0.04
IGL02423:Fer1l4 APN 2 156052907 missense probably benign 0.04
IGL02596:Fer1l4 APN 2 156039132 missense probably benign
IGL02612:Fer1l4 APN 2 156047928 missense probably damaging 1.00
IGL02716:Fer1l4 APN 2 156029715 missense probably damaging 1.00
IGL02738:Fer1l4 APN 2 156045728 missense probably benign
IGL03035:Fer1l4 APN 2 156022606 missense possibly damaging 0.95
IGL03083:Fer1l4 APN 2 156039366 unclassified probably benign
IGL03201:Fer1l4 APN 2 156044730 missense probably benign 0.32
IGL03349:Fer1l4 APN 2 156044734 nonsense probably null
R0033:Fer1l4 UTSW 2 156024106 splice site probably benign
R0356:Fer1l4 UTSW 2 156024010 missense probably damaging 1.00
R0477:Fer1l4 UTSW 2 156052886 missense probably benign 0.43
R0504:Fer1l4 UTSW 2 156052195 missense probably benign 0.36
R0731:Fer1l4 UTSW 2 156024070 missense probably benign 0.17
R0800:Fer1l4 UTSW 2 156045663 missense possibly damaging 0.90
R0884:Fer1l4 UTSW 2 156019313 missense possibly damaging 0.93
R1266:Fer1l4 UTSW 2 156046249 missense possibly damaging 0.89
R1544:Fer1l4 UTSW 2 156045633 missense probably benign 0.00
R1657:Fer1l4 UTSW 2 156035598 missense possibly damaging 0.95
R1699:Fer1l4 UTSW 2 156029685 missense probably benign 0.14
R1816:Fer1l4 UTSW 2 156035199 missense probably damaging 0.98
R1950:Fer1l4 UTSW 2 156048274 missense probably damaging 1.00
R2117:Fer1l4 UTSW 2 156039118 missense probably benign 0.00
R2219:Fer1l4 UTSW 2 156031764 missense probably damaging 0.99
R2220:Fer1l4 UTSW 2 156031764 missense probably damaging 0.99
R2879:Fer1l4 UTSW 2 156052200 missense probably damaging 1.00
R3746:Fer1l4 UTSW 2 156035048 missense probably benign 0.01
R3806:Fer1l4 UTSW 2 156045683 missense probably damaging 1.00
R3807:Fer1l4 UTSW 2 156045683 missense probably damaging 1.00
R4224:Fer1l4 UTSW 2 156020389 missense probably benign 0.37
R4274:Fer1l4 UTSW 2 156020544 missense probably damaging 1.00
R4569:Fer1l4 UTSW 2 156036639 missense possibly damaging 0.77
R4619:Fer1l4 UTSW 2 156047087 missense probably damaging 1.00
R4707:Fer1l4 UTSW 2 156045623 missense possibly damaging 0.69
R4914:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4915:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4917:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4918:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4941:Fer1l4 UTSW 2 156045089 missense probably damaging 1.00
R5011:Fer1l4 UTSW 2 156031215 missense probably damaging 1.00
R5013:Fer1l4 UTSW 2 156031215 missense probably damaging 1.00
R5130:Fer1l4 UTSW 2 156049466 missense possibly damaging 0.54
R5385:Fer1l4 UTSW 2 156037366 nonsense probably null
R5441:Fer1l4 UTSW 2 156023257 missense probably benign 0.00
R5555:Fer1l4 UTSW 2 156048189 missense probably damaging 1.00
R5838:Fer1l4 UTSW 2 156051993 missense probably benign 0.01
R6125:Fer1l4 UTSW 2 156046987 missense probably damaging 1.00
R6184:Fer1l4 UTSW 2 156048291 missense probably damaging 1.00
R6246:Fer1l4 UTSW 2 156024982 missense probably damaging 0.99
R6248:Fer1l4 UTSW 2 156046171 missense probably damaging 1.00
R6274:Fer1l4 UTSW 2 156029268 missense probably damaging 1.00
R6298:Fer1l4 UTSW 2 156024740 missense probably damaging 1.00
R6362:Fer1l4 UTSW 2 156048250 missense probably benign 0.08
R6490:Fer1l4 UTSW 2 156047914 missense possibly damaging 0.94
R6494:Fer1l4 UTSW 2 156045470 missense probably benign 0.02
R6516:Fer1l4 UTSW 2 156035199 missense probably damaging 0.98
R6530:Fer1l4 UTSW 2 156047865 critical splice donor site probably null
R6740:Fer1l4 UTSW 2 156031222 missense probably damaging 1.00
R7039:Fer1l4 UTSW 2 156036730 missense probably benign 0.05
R7121:Fer1l4 UTSW 2 156044557 missense probably benign 0.13
R7132:Fer1l4 UTSW 2 156045626 missense probably damaging 0.98
R7382:Fer1l4 UTSW 2 156020749 nonsense probably null
R7631:Fer1l4 UTSW 2 156048275 missense probably damaging 1.00
R7693:Fer1l4 UTSW 2 156020431 missense possibly damaging 0.51
R7730:Fer1l4 UTSW 2 156048934 missense probably benign
R8021:Fer1l4 UTSW 2 156022591 missense probably damaging 0.98
R8161:Fer1l4 UTSW 2 156024635 missense probably benign 0.03
R8171:Fer1l4 UTSW 2 156048231 missense probably benign 0.29
R8241:Fer1l4 UTSW 2 156049665 missense probably benign
R8245:Fer1l4 UTSW 2 156045014 critical splice donor site probably null
R8280:Fer1l4 UTSW 2 156049700 missense probably damaging 1.00
RF030:Fer1l4 UTSW 2 156045529 small deletion probably benign
X0063:Fer1l4 UTSW 2 156035011 missense probably damaging 1.00
Z1177:Fer1l4 UTSW 2 156048429 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGGCTTCATAGGACCTGTCACC -3'
(R):5'- GACTTTGGGACACCCATTCGAGAC -3'

Sequencing Primer
(F):5'- gctgtccacctgcctcc -3'
(R):5'- CCATTCGAGACAGGTAATCGTC -3'
Posted On2014-01-05