Incidental Mutation 'R1128:Mzf1'
ID96395
Institutional Source Beutler Lab
Gene Symbol Mzf1
Ensembl Gene ENSMUSG00000030380
Gene Namemyeloid zinc finger 1
SynonymsZnf42, Zfp121, Zfp98, Mzf2
MMRRC Submission 039201-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R1128 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location13042303-13054764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 13052771 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 124 (R124L)
Ref Sequence ENSEMBL: ENSMUSP00000138163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069289] [ENSMUST00000182087] [ENSMUST00000182490] [ENSMUST00000182515]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069289
AA Change: R124L

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000069122
Gene: ENSMUSG00000030380
AA Change: R124L

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
SCAN 41 153 1.18e-70 SMART
ZnF_C2H2 357 379 4.87e-4 SMART
ZnF_C2H2 385 407 1.95e-3 SMART
ZnF_C2H2 413 435 1.18e-2 SMART
ZnF_C2H2 441 463 8.6e-5 SMART
ZnF_C2H2 486 508 1.79e-2 SMART
ZnF_C2H2 514 536 7.15e-2 SMART
ZnF_C2H2 542 564 8.47e-4 SMART
ZnF_C2H2 570 592 2.79e-4 SMART
ZnF_C2H2 598 620 1.6e-4 SMART
ZnF_C2H2 626 648 1.67e-2 SMART
ZnF_C2H2 654 676 3.44e-4 SMART
ZnF_C2H2 682 704 2.84e-5 SMART
ZnF_C2H2 710 732 2.4e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182087
AA Change: R124L

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138163
Gene: ENSMUSG00000030380
AA Change: R124L

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
SCAN 41 152 9.06e-58 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182293
Predicted Effect possibly damaging
Transcript: ENSMUST00000182490
AA Change: R203L

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138271
Gene: ENSMUSG00000030380
AA Change: R203L

DomainStartEndE-ValueType
low complexity region 103 113 N/A INTRINSIC
SCAN 120 232 1.18e-70 SMART
ZnF_C2H2 436 458 4.87e-4 SMART
ZnF_C2H2 464 486 1.95e-3 SMART
ZnF_C2H2 492 514 1.18e-2 SMART
ZnF_C2H2 520 542 8.6e-5 SMART
ZnF_C2H2 565 587 1.79e-2 SMART
ZnF_C2H2 593 615 7.15e-2 SMART
ZnF_C2H2 621 643 8.47e-4 SMART
ZnF_C2H2 649 671 2.79e-4 SMART
ZnF_C2H2 677 699 1.6e-4 SMART
ZnF_C2H2 705 727 1.67e-2 SMART
ZnF_C2H2 733 755 3.44e-4 SMART
ZnF_C2H2 761 783 2.84e-5 SMART
ZnF_C2H2 789 811 2.4e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182515
AA Change: R124L

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138387
Gene: ENSMUSG00000030380
AA Change: R124L

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
SCAN 41 153 1.18e-70 SMART
ZnF_C2H2 357 379 4.87e-4 SMART
ZnF_C2H2 385 407 1.95e-3 SMART
ZnF_C2H2 413 435 1.18e-2 SMART
ZnF_C2H2 441 463 8.6e-5 SMART
ZnF_C2H2 486 508 1.79e-2 SMART
ZnF_C2H2 514 536 7.15e-2 SMART
ZnF_C2H2 542 564 8.47e-4 SMART
ZnF_C2H2 570 592 2.79e-4 SMART
ZnF_C2H2 598 620 1.6e-4 SMART
ZnF_C2H2 626 648 1.67e-2 SMART
ZnF_C2H2 654 676 3.44e-4 SMART
ZnF_C2H2 682 704 2.84e-5 SMART
ZnF_C2H2 710 732 2.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210727
Meta Mutation Damage Score 0.1109 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutants are prone to late-onset (>2 yr) neoplasias characterized by infiltration, enlargement and disruption of the liver by monomorphic cells of myeloid origin; hemopoietic progenitors show increased ability to sustain long-term hemopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akp3 G A 1: 87,127,871 G547R unknown Het
Amhr2 A T 15: 102,452,821 Q402L probably benign Het
Brip1 A T 11: 86,064,937 L917M possibly damaging Het
Dennd5a G A 7: 109,921,334 R415* probably null Het
Eif2ak1 G T 5: 143,899,176 probably null Het
Golga4 G A 9: 118,548,784 A458T probably benign Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Ift88 C T 14: 57,517,019 R762* probably null Het
Kansl2 A T 15: 98,533,685 C28* probably null Het
Lct T C 1: 128,301,309 R816G probably damaging Het
Obscn T C 11: 59,028,943 N6809S probably null Het
Pak6 A G 2: 118,696,509 T662A probably benign Het
Pglyrp3 T C 3: 92,028,172 F243S probably benign Het
Rab44 T C 17: 29,140,461 V541A possibly damaging Het
Slc39a6 G T 18: 24,585,292 H569Q probably damaging Het
Slc4a7 T C 14: 14,733,832 S87P probably damaging Het
Spocd1 T C 4: 129,956,806 V875A possibly damaging Het
Tspan17 A G 13: 54,795,171 D146G probably damaging Het
Other mutations in Mzf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Mzf1 APN 7 13044616 missense possibly damaging 0.85
IGL01728:Mzf1 APN 7 13051727 splice site probably benign
IGL02194:Mzf1 APN 7 13043720 missense possibly damaging 0.53
IGL02256:Mzf1 APN 7 13052737 splice site probably benign
IGL02584:Mzf1 APN 7 13052817 missense probably damaging 0.98
IGL02678:Mzf1 APN 7 13052909 missense possibly damaging 0.51
R0903:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R0904:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R0905:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R1131:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R1280:Mzf1 UTSW 7 13053083 missense probably damaging 0.96
R1400:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R1640:Mzf1 UTSW 7 13043270 makesense probably null
R1687:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R4014:Mzf1 UTSW 7 13043956 missense possibly damaging 0.47
R4721:Mzf1 UTSW 7 13043296 missense possibly damaging 0.52
R4721:Mzf1 UTSW 7 13043521 missense possibly damaging 0.53
R5511:Mzf1 UTSW 7 13051599 missense possibly damaging 0.95
R5611:Mzf1 UTSW 7 13044627 utr 3 prime probably benign
R5728:Mzf1 UTSW 7 13044058 missense probably benign 0.00
R5868:Mzf1 UTSW 7 13053189 missense probably benign 0.00
R6283:Mzf1 UTSW 7 13053369 intron probably benign
R7059:Mzf1 UTSW 7 13053058 missense probably damaging 0.96
R7066:Mzf1 UTSW 7 13043563 missense possibly damaging 0.92
R7763:Mzf1 UTSW 7 13044091 missense probably damaging 1.00
R8157:Mzf1 UTSW 7 13044352 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATCCAAAGTCCTGAACTTCCCC -3'
(R):5'- GCTACGCCCAGAAGTACATTCCAAG -3'

Sequencing Primer
(F):5'- CTCTTTTGACCTTGAGCAGAAAGC -3'
(R):5'- TACATTCCAAGGAACAGGTGC -3'
Posted On2014-01-05