Incidental Mutation 'R1128:Dennd5a'
ID96400
Institutional Source Beutler Lab
Gene Symbol Dennd5a
Ensembl Gene ENSMUSG00000035901
Gene NameDENN/MADD domain containing 5A
Synonyms1500012B19Rik, Rab6ip1, ORF37
MMRRC Submission 039201-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R1128 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location109893780-109960470 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 109921334 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 415 (R415*)
Ref Sequence ENSEMBL: ENSMUSP00000102333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080437] [ENSMUST00000106722]
Predicted Effect probably null
Transcript: ENSMUST00000080437
AA Change: R439*
SMART Domains Protein: ENSMUSP00000079295
Gene: ENSMUSG00000035901
AA Change: R439*

DomainStartEndE-ValueType
uDENN 12 138 7.71e-45 SMART
DENN 202 390 9.28e-80 SMART
dDENN 512 588 4.06e-21 SMART
low complexity region 832 844 N/A INTRINSIC
RUN 884 947 4.9e-22 SMART
Pfam:PLAT 956 1062 1e-15 PFAM
RUN 1218 1278 3.69e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106722
AA Change: R415*
SMART Domains Protein: ENSMUSP00000102333
Gene: ENSMUSG00000035901
AA Change: R415*

DomainStartEndE-ValueType
uDENN 12 114 2.32e-39 SMART
DENN 178 366 9.28e-80 SMART
dDENN 488 564 4.06e-21 SMART
low complexity region 808 820 N/A INTRINSIC
RUN 860 923 4.9e-22 SMART
Pfam:PLAT 932 1038 2.8e-18 PFAM
RUN 1194 1254 3.69e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154002
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN-domain-containing protein that functions as a RAB-activating guanine nucleotide exchange factor (GEF). This protein catalyzes the conversion of GDP to GTP and thereby converts inactive GDP-bound Rab proteins into their active GTP-bound form. The encoded protein is recruited by RAB6 onto Golgi membranes and is therefore referred to as RAB6-interacting protein 1. This protein binds with RAB39 as well. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene are associated with early infantile epileptic encephalopathy-49. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akp3 G A 1: 87,127,871 G547R unknown Het
Amhr2 A T 15: 102,452,821 Q402L probably benign Het
Brip1 A T 11: 86,064,937 L917M possibly damaging Het
Eif2ak1 G T 5: 143,899,176 probably null Het
Golga4 G A 9: 118,548,784 A458T probably benign Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Ift88 C T 14: 57,517,019 R762* probably null Het
Kansl2 A T 15: 98,533,685 C28* probably null Het
Lct T C 1: 128,301,309 R816G probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Obscn T C 11: 59,028,943 N6809S probably null Het
Pak6 A G 2: 118,696,509 T662A probably benign Het
Pglyrp3 T C 3: 92,028,172 F243S probably benign Het
Rab44 T C 17: 29,140,461 V541A possibly damaging Het
Slc39a6 G T 18: 24,585,292 H569Q probably damaging Het
Slc4a7 T C 14: 14,733,832 S87P probably damaging Het
Spocd1 T C 4: 129,956,806 V875A possibly damaging Het
Tspan17 A G 13: 54,795,171 D146G probably damaging Het
Other mutations in Dennd5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Dennd5a APN 7 109908372 missense probably benign
IGL01338:Dennd5a APN 7 109919404 missense possibly damaging 0.92
IGL01618:Dennd5a APN 7 109934095 missense probably damaging 1.00
IGL02047:Dennd5a APN 7 109934784 missense possibly damaging 0.92
IGL02277:Dennd5a APN 7 109897969 missense possibly damaging 0.61
IGL02492:Dennd5a APN 7 109933637 missense probably benign
IGL02697:Dennd5a APN 7 109894781 missense probably damaging 1.00
IGL02935:Dennd5a APN 7 109921307 missense possibly damaging 0.80
IGL02986:Dennd5a APN 7 109935524 missense probably benign
IGL03088:Dennd5a APN 7 109908381 missense probably damaging 1.00
IGL03156:Dennd5a APN 7 109919255 splice site probably benign
IGL03181:Dennd5a APN 7 109933658 missense probably damaging 1.00
big_pal UTSW 7 109919423 nonsense probably null
Celestial UTSW 7 109901089 missense probably damaging 1.00
PIT4434001:Dennd5a UTSW 7 109933624 missense probably damaging 1.00
R0055:Dennd5a UTSW 7 109899791 missense possibly damaging 0.72
R0055:Dennd5a UTSW 7 109899791 missense possibly damaging 0.72
R0092:Dennd5a UTSW 7 109899806 missense possibly damaging 0.95
R0111:Dennd5a UTSW 7 109934754 missense probably damaging 1.00
R0517:Dennd5a UTSW 7 109934761 missense probably damaging 1.00
R0546:Dennd5a UTSW 7 109921426 missense probably benign 0.01
R0811:Dennd5a UTSW 7 109933613 missense possibly damaging 0.93
R0812:Dennd5a UTSW 7 109933613 missense possibly damaging 0.93
R0827:Dennd5a UTSW 7 109899731 missense probably damaging 1.00
R0831:Dennd5a UTSW 7 109934754 missense probably damaging 1.00
R1075:Dennd5a UTSW 7 109918601 missense probably benign
R1115:Dennd5a UTSW 7 109918761 missense probably damaging 1.00
R1300:Dennd5a UTSW 7 109919407 missense probably benign
R1698:Dennd5a UTSW 7 109917380 splice site probably null
R1711:Dennd5a UTSW 7 109918712 missense probably benign 0.00
R1771:Dennd5a UTSW 7 109918686 missense probably damaging 0.98
R1803:Dennd5a UTSW 7 109898613 missense probably benign 0.00
R2064:Dennd5a UTSW 7 109898693 splice site probably benign
R2176:Dennd5a UTSW 7 109905120 splice site probably null
R2182:Dennd5a UTSW 7 109933994 missense probably benign 0.03
R2852:Dennd5a UTSW 7 109933671 missense probably damaging 1.00
R2853:Dennd5a UTSW 7 109933671 missense probably damaging 1.00
R3035:Dennd5a UTSW 7 109921352 missense probably benign 0.00
R3835:Dennd5a UTSW 7 109934242 missense probably benign 0.00
R3953:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3954:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3955:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3957:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R4014:Dennd5a UTSW 7 109935481 critical splice donor site probably null
R4166:Dennd5a UTSW 7 109926825 critical splice donor site probably null
R4362:Dennd5a UTSW 7 109896343 missense probably damaging 1.00
R4567:Dennd5a UTSW 7 109899735 missense probably benign 0.06
R4700:Dennd5a UTSW 7 109921198 missense probably benign 0.01
R4734:Dennd5a UTSW 7 109896336 missense probably damaging 0.96
R4914:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4915:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4918:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4992:Dennd5a UTSW 7 109894712 missense probably damaging 0.98
R5011:Dennd5a UTSW 7 109914776 missense possibly damaging 0.89
R5013:Dennd5a UTSW 7 109914776 missense possibly damaging 0.89
R5034:Dennd5a UTSW 7 109899797 missense probably damaging 0.98
R5194:Dennd5a UTSW 7 109933729 missense probably damaging 1.00
R5359:Dennd5a UTSW 7 109897962 missense probably damaging 1.00
R5430:Dennd5a UTSW 7 109934240 missense probably damaging 1.00
R5586:Dennd5a UTSW 7 109905721 missense possibly damaging 0.72
R5607:Dennd5a UTSW 7 109919423 nonsense probably null
R5608:Dennd5a UTSW 7 109919423 nonsense probably null
R5783:Dennd5a UTSW 7 109894636 missense probably damaging 0.97
R5866:Dennd5a UTSW 7 109919360 missense probably benign 0.00
R5890:Dennd5a UTSW 7 109934221 missense probably benign 0.00
R6053:Dennd5a UTSW 7 109933745 missense probably damaging 1.00
R6247:Dennd5a UTSW 7 109898682 missense probably damaging 1.00
R6362:Dennd5a UTSW 7 109934265 nonsense probably null
R6446:Dennd5a UTSW 7 109894666 missense probably damaging 1.00
R6894:Dennd5a UTSW 7 109901118 missense probably damaging 1.00
R7061:Dennd5a UTSW 7 109905179 missense probably benign 0.19
R7115:Dennd5a UTSW 7 109894754 missense probably damaging 1.00
R7133:Dennd5a UTSW 7 109896242 critical splice donor site probably null
R7302:Dennd5a UTSW 7 109905699 missense probably damaging 0.98
R7339:Dennd5a UTSW 7 109901159 missense probably damaging 1.00
R7704:Dennd5a UTSW 7 109896967 missense possibly damaging 0.85
R7756:Dennd5a UTSW 7 109921507 missense possibly damaging 0.95
R7838:Dennd5a UTSW 7 109933989 missense probably benign
R7873:Dennd5a UTSW 7 109926934 missense probably damaging 1.00
R8124:Dennd5a UTSW 7 109897935 missense probably damaging 1.00
R8309:Dennd5a UTSW 7 109901125 missense probably damaging 1.00
R8345:Dennd5a UTSW 7 109905270 missense possibly damaging 0.55
Z1088:Dennd5a UTSW 7 109894747 missense possibly damaging 0.73
Z1088:Dennd5a UTSW 7 109905273 missense probably damaging 1.00
Z1177:Dennd5a UTSW 7 109934024 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGAGCTGCTTGTGCTCAGTCTCC -3'
(R):5'- CAGGCTAACCTCTGCTTTGTGGATG -3'

Sequencing Primer
(F):5'- tgggaggcagaggcagg -3'
(R):5'- TCTGAGATCCTCATGGCCTT -3'
Posted On2014-01-05