Incidental Mutation 'R1017:Ccin'
ID96413
Institutional Source Beutler Lab
Gene Symbol Ccin
Ensembl Gene ENSMUSG00000070999
Gene Namecalicin
Synonyms
MMRRC Submission 039121-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.396) question?
Stock #R1017 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43983483-43985423 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43985222 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 543 (D543G)
Ref Sequence ENSEMBL: ENSMUSP00000092725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095107]
Predicted Effect probably benign
Transcript: ENSMUST00000095107
AA Change: D543G

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000092725
Gene: ENSMUSG00000070999
AA Change: D543G

DomainStartEndE-ValueType
BTB 28 128 1.55e-21 SMART
BACK 133 237 4.4e-7 SMART
Kelch 280 327 2.3e0 SMART
Kelch 328 375 2.39e-6 SMART
Kelch 376 423 2.56e0 SMART
Blast:Kelch 526 580 7e-22 BLAST
Meta Mutation Damage Score 0.1010 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a basic protein of the sperm head cytoskeleton. This protein contains kelch repeats and a BTB/POZ domain and is necessary for normal morphology during sperm differentiation. This gene is intronless. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp C T 6: 125,061,260 probably benign Het
Ahnak A T 19: 9,010,543 I3064F probably damaging Het
Arhgef10l C A 4: 140,515,306 R884L probably damaging Het
Baiap2l2 A G 15: 79,261,243 F317L probably benign Het
Brinp2 A T 1: 158,249,451 I358N probably damaging Het
Cdh23 T A 10: 60,331,793 D1806V probably damaging Het
Cdh6 C T 15: 13,051,476 R357Q probably benign Het
Cpa3 T C 3: 20,239,633 M64V possibly damaging Het
Ctnnb1 T A 9: 120,950,728 F74I probably damaging Het
Cyp7a1 A T 4: 6,272,307 I302N probably damaging Het
Dnase1l2 C T 17: 24,442,472 A56T probably benign Het
Dscam T A 16: 96,833,433 D190V probably damaging Het
Fer1l4 T C 2: 156,049,478 probably null Het
Fscb T A 12: 64,473,468 D408V probably benign Het
Gm10306 A G 4: 94,556,720 probably benign Het
Gon4l T A 3: 88,858,496 M409K probably benign Het
Gsx2 T C 5: 75,077,262 S292P probably damaging Het
Hira T A 16: 18,899,347 probably null Het
Hoxa3 G T 6: 52,172,406 probably null Het
Irak3 T C 10: 120,142,884 E554G possibly damaging Het
Itgb3bp A G 4: 99,769,487 probably benign Het
Kifc3 C T 8: 95,105,785 D379N probably damaging Het
Lama5 A G 2: 180,195,420 V1032A probably damaging Het
Lmln T G 16: 33,088,176 I324R probably benign Het
Ltbp4 A G 7: 27,306,076 S1547P possibly damaging Het
Mdga1 T A 17: 29,850,548 T175S probably damaging Het
Mrps6 T A 16: 92,058,458 L8* probably null Het
Mtmr11 A C 3: 96,164,477 T203P probably damaging Het
Nat8f7 T C 6: 85,707,570 D96G probably damaging Het
Obscn T C 11: 58,998,353 E7531G unknown Het
Olfr1061 A T 2: 86,413,511 D180E probably damaging Het
Olfr1065 A T 2: 86,445,428 L185I probably benign Het
Olfr267 A T 4: 58,785,115 S202R probably damaging Het
Osbpl6 A G 2: 76,549,719 Y69C probably damaging Het
Polrmt C T 10: 79,743,509 W136* probably null Het
Raver1 T C 9: 21,079,590 probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rsl1d1 T C 16: 11,203,252 K2E probably benign Het
Sik3 C T 9: 46,195,809 T417I probably benign Het
Spdl1 T C 11: 34,819,290 K388R possibly damaging Het
Tulp1 T C 17: 28,364,303 R88G probably damaging Het
Vldlr A C 19: 27,241,333 Y528S probably damaging Het
Zdhhc14 T A 17: 5,493,649 L68H probably damaging Het
Zfp605 C T 5: 110,127,994 T326I probably benign Het
Other mutations in Ccin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Ccin APN 4 43984069 missense probably damaging 1.00
IGL01688:Ccin APN 4 43984985 missense possibly damaging 0.95
R1707:Ccin UTSW 4 43983947 missense probably benign
R1709:Ccin UTSW 4 43984133 missense probably damaging 1.00
R4657:Ccin UTSW 4 43984981 missense probably damaging 1.00
R4954:Ccin UTSW 4 43985077 missense probably benign
R5958:Ccin UTSW 4 43983854 missense probably damaging 0.98
R6034:Ccin UTSW 4 43985354 missense probably benign 0.00
R6034:Ccin UTSW 4 43985354 missense probably benign 0.00
R6768:Ccin UTSW 4 43984574 missense probably benign
Z1176:Ccin UTSW 4 43985018 missense probably damaging 0.97
Z1177:Ccin UTSW 4 43984902 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTCTCGTTCCATCAGGACAACATC -3'
(R):5'- TGTGTAGCCCCAAGCATTGACC -3'

Sequencing Primer
(F):5'- TCAGGACAACATCCTTCGTG -3'
(R):5'- GGAATCCAAAGTCACATTCCTC -3'
Posted On2014-01-05