Incidental Mutation 'R1128:Hist1h1t'
ID96419
Institutional Source Beutler Lab
Gene Symbol Hist1h1t
Ensembl Gene ENSMUSG00000036211
Gene Namehistone cluster 1, H1t
SynonymsH1ft
MMRRC Submission 039201-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1128 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23695814-23696725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 23696324 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 153 (K153N)
Ref Sequence ENSEMBL: ENSMUSP00000037304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018246] [ENSMUST00000041052] [ENSMUST00000102967]
Predicted Effect probably benign
Transcript: ENSMUST00000018246
SMART Domains Protein: ENSMUSP00000018246
Gene: ENSMUSG00000018102

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000041052
AA Change: K153N

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037304
Gene: ENSMUSG00000036211
AA Change: K153N

DomainStartEndE-ValueType
H15 37 102 5.15e-21 SMART
low complexity region 111 135 N/A INTRINSIC
low complexity region 142 161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102967
SMART Domains Protein: ENSMUSP00000100032
Gene: ENSMUSG00000060678

DomainStartEndE-ValueType
H4 16 90 2.59e-29 SMART
Meta Mutation Damage Score 0.1509 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice develop normally and exhibit normal testicular morphology, spermatogenesis and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akp3 G A 1: 87,127,871 G547R unknown Het
Amhr2 A T 15: 102,452,821 Q402L probably benign Het
Brip1 A T 11: 86,064,937 L917M possibly damaging Het
Dennd5a G A 7: 109,921,334 R415* probably null Het
Eif2ak1 G T 5: 143,899,176 probably null Het
Golga4 G A 9: 118,548,784 A458T probably benign Het
Ift88 C T 14: 57,517,019 R762* probably null Het
Kansl2 A T 15: 98,533,685 C28* probably null Het
Lct T C 1: 128,301,309 R816G probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Obscn T C 11: 59,028,943 N6809S probably null Het
Pak6 A G 2: 118,696,509 T662A probably benign Het
Pglyrp3 T C 3: 92,028,172 F243S probably benign Het
Rab44 T C 17: 29,140,461 V541A possibly damaging Het
Slc39a6 G T 18: 24,585,292 H569Q probably damaging Het
Slc4a7 T C 14: 14,733,832 S87P probably damaging Het
Spocd1 T C 4: 129,956,806 V875A possibly damaging Het
Tspan17 A G 13: 54,795,171 D146G probably damaging Het
Other mutations in Hist1h1t
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Hist1h1t APN 13 23696049 missense probably damaging 0.98
FR4304:Hist1h1t UTSW 13 23695920 unclassified probably benign
FR4342:Hist1h1t UTSW 13 23695913 unclassified probably benign
FR4548:Hist1h1t UTSW 13 23695920 unclassified probably benign
R0167:Hist1h1t UTSW 13 23695903 missense probably benign 0.02
R0238:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R0238:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R0564:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R0726:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R0827:Hist1h1t UTSW 13 23696221 missense probably benign 0.01
R0972:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R1129:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R1130:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R5652:Hist1h1t UTSW 13 23696236 missense probably benign 0.01
R5827:Hist1h1t UTSW 13 23696202 missense possibly damaging 0.91
R6538:Hist1h1t UTSW 13 23695921 missense probably benign 0.06
R7729:Hist1h1t UTSW 13 23696472 missense possibly damaging 0.93
R7774:Hist1h1t UTSW 13 23696200 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CGTGGAGAAGAACAACAGCCGTATC -3'
(R):5'- GTGGAAGCTCCTACTGGCGTTATC -3'

Sequencing Primer
(F):5'- GTATCAAGCTGGCCCTCAAGAG -3'
(R):5'- CTAGGGTTTCAACGACAGGTC -3'
Posted On2014-01-05