Incidental Mutation 'R1128:Tspan17'
ID96421
Institutional Source Beutler Lab
Gene Symbol Tspan17
Ensembl Gene ENSMUSG00000025875
Gene Nametetraspanin 17
Synonyms2210021G21Rik, Fbxo23, Tm4sf17
MMRRC Submission 039201-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1128 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location54789377-54796776 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54795171 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 146 (D146G)
Ref Sequence ENSEMBL: ENSMUSP00000123607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026993] [ENSMUST00000099503] [ENSMUST00000130568] [ENSMUST00000131692] [ENSMUST00000163796] [ENSMUST00000163915]
Predicted Effect probably damaging
Transcript: ENSMUST00000026993
AA Change: D192G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026993
Gene: ENSMUSG00000025875
AA Change: D192G

DomainStartEndE-ValueType
Pfam:Tetraspannin 16 263 6.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099503
AA Change: D192G

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097102
Gene: ENSMUSG00000025875
AA Change: D192G

DomainStartEndE-ValueType
Pfam:Tetraspannin 16 266 1.3e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130568
AA Change: D146G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123607
Gene: ENSMUSG00000025875
AA Change: D146G

DomainStartEndE-ValueType
Pfam:Tetraspannin 3 174 1.2e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000131692
AA Change: D192G

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115287
Gene: ENSMUSG00000025875
AA Change: D192G

DomainStartEndE-ValueType
Pfam:Tetraspannin 15 263 8.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139574
Predicted Effect unknown
Transcript: ENSMUST00000145574
AA Change: D102G
SMART Domains Protein: ENSMUSP00000119687
Gene: ENSMUSG00000025875
AA Change: D102G

DomainStartEndE-ValueType
Pfam:Tetraspannin 1 174 8.2e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163796
AA Change: D126G

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131671
Gene: ENSMUSG00000025875
AA Change: D126G

DomainStartEndE-ValueType
Pfam:Tetraspannin 13 193 4.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163915
SMART Domains Protein: ENSMUSP00000130765
Gene: ENSMUSG00000025875

DomainStartEndE-ValueType
Pfam:Tetraspannin 13 143 5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171859
SMART Domains Protein: ENSMUSP00000128568
Gene: ENSMUSG00000025875

DomainStartEndE-ValueType
Pfam:Tetraspannin 1 79 3.6e-17 PFAM
Pfam:Tetraspannin 78 144 1.5e-13 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transmembrane 4 superfamily. It is characterized by four tetraspanin transmembrane segments. The function of this gene has not yet been determined. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akp3 G A 1: 87,127,871 G547R unknown Het
Amhr2 A T 15: 102,452,821 Q402L probably benign Het
Brip1 A T 11: 86,064,937 L917M possibly damaging Het
Dennd5a G A 7: 109,921,334 R415* probably null Het
Eif2ak1 G T 5: 143,899,176 probably null Het
Golga4 G A 9: 118,548,784 A458T probably benign Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Ift88 C T 14: 57,517,019 R762* probably null Het
Kansl2 A T 15: 98,533,685 C28* probably null Het
Lct T C 1: 128,301,309 R816G probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Obscn T C 11: 59,028,943 N6809S probably null Het
Pak6 A G 2: 118,696,509 T662A probably benign Het
Pglyrp3 T C 3: 92,028,172 F243S probably benign Het
Rab44 T C 17: 29,140,461 V541A possibly damaging Het
Slc39a6 G T 18: 24,585,292 H569Q probably damaging Het
Slc4a7 T C 14: 14,733,832 S87P probably damaging Het
Spocd1 T C 4: 129,956,806 V875A possibly damaging Het
Other mutations in Tspan17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02681:Tspan17 APN 13 54789629 missense probably damaging 0.99
R0745:Tspan17 UTSW 13 54789674 missense possibly damaging 0.45
R4738:Tspan17 UTSW 13 54795064 nonsense probably null
R5905:Tspan17 UTSW 13 54793298 missense probably damaging 0.98
R6028:Tspan17 UTSW 13 54793298 missense probably damaging 0.98
R6389:Tspan17 UTSW 13 54795616 splice site probably null
R6919:Tspan17 UTSW 13 54796033 missense probably damaging 1.00
R7050:Tspan17 UTSW 13 54796063 missense probably benign 0.39
R7346:Tspan17 UTSW 13 54792621 missense probably benign 0.01
R7408:Tspan17 UTSW 13 54789653 missense probably benign 0.15
R7429:Tspan17 UTSW 13 54795972 missense probably benign 0.03
R7430:Tspan17 UTSW 13 54795972 missense probably benign 0.03
Z1177:Tspan17 UTSW 13 54792778 frame shift probably null
Z1177:Tspan17 UTSW 13 54796221 makesense probably null
Predicted Primers PCR Primer
(F):5'- CAGTGAGTCTGAAATGCCTCGATCC -3'
(R):5'- CTAGTGCCCCTCCTTCACAGAAAAG -3'

Sequencing Primer
(F):5'- ccagccagccagccTTC -3'
(R):5'- TCCTTCACAGAAAAGCAAACGG -3'
Posted On2014-01-05