Incidental Mutation 'R1128:Slc4a7'
ID96426
Institutional Source Beutler Lab
Gene Symbol Slc4a7
Ensembl Gene ENSMUSG00000021733
Gene Namesolute carrier family 4, sodium bicarbonate cotransporter, member 7
SynonymsNBC3, NBCn1, E430014N10Rik
MMRRC Submission 039201-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R1128 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location14702279-14799940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14733832 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 87 (S87P)
Ref Sequence ENSEMBL: ENSMUSP00000153470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057015] [ENSMUST00000223607] [ENSMUST00000223695] [ENSMUST00000223740] [ENSMUST00000223761] [ENSMUST00000223981] [ENSMUST00000224049] [ENSMUST00000224222] [ENSMUST00000224333] [ENSMUST00000224672] [ENSMUST00000224752] [ENSMUST00000225232] [ENSMUST00000225175] [ENSMUST00000225630] [ENSMUST00000225238] [ENSMUST00000226079] [ENSMUST00000225979]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057015
AA Change: S81P

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000058313
Gene: ENSMUSG00000021733
AA Change: S81P

DomainStartEndE-ValueType
low complexity region 57 89 N/A INTRINSIC
Pfam:Band_3_cyto 146 413 1.4e-110 PFAM
Pfam:HCO3_cotransp 456 969 1.6e-242 PFAM
transmembrane domain 977 999 N/A INTRINSIC
coiled coil region 1021 1050 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223607
AA Change: S81P

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223695
AA Change: S87P

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000223740
AA Change: S87P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223761
AA Change: S81P

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223981
AA Change: S81P

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224049
AA Change: S87P

PolyPhen 2 Score 0.538 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224197
Predicted Effect probably benign
Transcript: ENSMUST00000224222
AA Change: S81P

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably damaging
Transcript: ENSMUST00000224333
AA Change: S87P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224672
AA Change: S87P

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000224752
AA Change: S86P

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000225232
AA Change: S81P

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000225175
AA Change: S81P

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000225630
AA Change: S81P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000225238
AA Change: S81P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000226079
AA Change: S81P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000225979
AA Change: S81P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect unknown
Transcript: ENSMUST00000224952
AA Change: S100P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225496
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a sodium bicarbonate cotransporter. The encoded transmembrane protein appears to transport sodium and bicarbonate ions in a 1:1 ratio, and is thus considered an electroneutral cotransporter. The encoded protein likely plays a critical role in regulation of intracellular pH involved in visual and auditory sensory transmission. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a disruption at this locus display defects of the auditory and visual systems similar to those observed in patients with Ushers syndrome. Mice homozygous for a gene trap allele exhibit disruption in sodium/bicarbonate function that impacts vasodilation and hypertension. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akp3 G A 1: 87,127,871 G547R unknown Het
Amhr2 A T 15: 102,452,821 Q402L probably benign Het
Brip1 A T 11: 86,064,937 L917M possibly damaging Het
Dennd5a G A 7: 109,921,334 R415* probably null Het
Eif2ak1 G T 5: 143,899,176 probably null Het
Golga4 G A 9: 118,548,784 A458T probably benign Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Ift88 C T 14: 57,517,019 R762* probably null Het
Kansl2 A T 15: 98,533,685 C28* probably null Het
Lct T C 1: 128,301,309 R816G probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Obscn T C 11: 59,028,943 N6809S probably null Het
Pak6 A G 2: 118,696,509 T662A probably benign Het
Pglyrp3 T C 3: 92,028,172 F243S probably benign Het
Rab44 T C 17: 29,140,461 V541A possibly damaging Het
Slc39a6 G T 18: 24,585,292 H569Q probably damaging Het
Spocd1 T C 4: 129,956,806 V875A possibly damaging Het
Tspan17 A G 13: 54,795,171 D146G probably damaging Het
Other mutations in Slc4a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00974:Slc4a7 APN 14 14760292 missense probably benign 0.18
IGL01468:Slc4a7 APN 14 14737480 missense probably damaging 1.00
IGL01863:Slc4a7 APN 14 14762430 missense probably damaging 0.97
IGL03122:Slc4a7 APN 14 14782040 splice site probably benign
R0020:Slc4a7 UTSW 14 14796108 missense probably benign
R0403:Slc4a7 UTSW 14 14766808 missense probably benign 0.02
R0410:Slc4a7 UTSW 14 14738299 missense probably damaging 1.00
R0624:Slc4a7 UTSW 14 14794059 critical splice donor site probably null
R0631:Slc4a7 UTSW 14 14757382 missense probably damaging 1.00
R1556:Slc4a7 UTSW 14 14778872 missense probably benign 0.01
R1672:Slc4a7 UTSW 14 14760247 missense possibly damaging 0.91
R1711:Slc4a7 UTSW 14 14765709 missense probably benign 0.45
R1870:Slc4a7 UTSW 14 14737509 critical splice donor site probably null
R1939:Slc4a7 UTSW 14 14748581 missense probably damaging 1.00
R2012:Slc4a7 UTSW 14 14733727 nonsense probably null
R2042:Slc4a7 UTSW 14 14737386 missense probably damaging 1.00
R2064:Slc4a7 UTSW 14 14733773 missense probably damaging 1.00
R2404:Slc4a7 UTSW 14 14733733 missense probably damaging 1.00
R2880:Slc4a7 UTSW 14 14773277 missense probably damaging 1.00
R3729:Slc4a7 UTSW 14 14729276 missense probably damaging 1.00
R4368:Slc4a7 UTSW 14 14733775 missense probably damaging 1.00
R4395:Slc4a7 UTSW 14 14765665 missense probably damaging 1.00
R4432:Slc4a7 UTSW 14 14757323 missense probably damaging 1.00
R4592:Slc4a7 UTSW 14 14778850 missense probably damaging 1.00
R4705:Slc4a7 UTSW 14 14733856 missense probably damaging 1.00
R4743:Slc4a7 UTSW 14 14796073 splice site probably null
R4765:Slc4a7 UTSW 14 14762414 missense probably damaging 1.00
R4831:Slc4a7 UTSW 14 14772699 critical splice donor site probably null
R4845:Slc4a7 UTSW 14 14733803 missense probably damaging 1.00
R4880:Slc4a7 UTSW 14 14757342 missense probably damaging 1.00
R4948:Slc4a7 UTSW 14 14771283 missense possibly damaging 0.68
R5348:Slc4a7 UTSW 14 14786310 missense probably benign 0.02
R5385:Slc4a7 UTSW 14 14773345 missense possibly damaging 0.94
R5418:Slc4a7 UTSW 14 14760280 missense probably benign 0.25
R5480:Slc4a7 UTSW 14 14782138 missense probably damaging 1.00
R5842:Slc4a7 UTSW 14 14778866 missense probably damaging 1.00
R5919:Slc4a7 UTSW 14 14791092 missense probably benign
R6063:Slc4a7 UTSW 14 14793964 missense possibly damaging 0.60
R6065:Slc4a7 UTSW 14 14739836 missense probably benign 0.29
R6549:Slc4a7 UTSW 14 14748564 missense probably damaging 1.00
R6845:Slc4a7 UTSW 14 14775000 missense probably damaging 1.00
R6870:Slc4a7 UTSW 14 14733846 missense probably damaging 1.00
R6881:Slc4a7 UTSW 14 14737452 missense probably benign 0.43
R6962:Slc4a7 UTSW 14 14746021 missense probably damaging 0.99
R7099:Slc4a7 UTSW 14 14733750 missense probably damaging 1.00
R7180:Slc4a7 UTSW 14 14765580 missense probably damaging 1.00
R7346:Slc4a7 UTSW 14 14775000 missense probably damaging 1.00
R7378:Slc4a7 UTSW 14 14757421 missense probably damaging 1.00
R7646:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R7647:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R7648:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R7650:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R7857:Slc4a7 UTSW 14 14772624 missense probably benign 0.00
R7892:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R8124:Slc4a7 UTSW 14 14729211 missense possibly damaging 0.92
R8225:Slc4a7 UTSW 14 14738224 nonsense probably null
X0067:Slc4a7 UTSW 14 14771276 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGTGATGCGCTTTCTTGAATGTCATACT -3'
(R):5'- GTGGATGAGAACCAACTGCTATGTGAG -3'

Sequencing Primer
(F):5'- CTTGAATGTCATACTTTCACTTTGG -3'
(R):5'- actgctgatgaaaacaaaaatgac -3'
Posted On2014-01-05