Incidental Mutation 'R1128:Amhr2'
ID96432
Institutional Source Beutler Lab
Gene Symbol Amhr2
Ensembl Gene ENSMUSG00000023047
Gene Nameanti-Mullerian hormone type 2 receptor
SynonymsMIS TypeII receptor, MISIIR
MMRRC Submission 039201-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.771) question?
Stock #R1128 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location102445367-102454633 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102452821 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 402 (Q402L)
Ref Sequence ENSEMBL: ENSMUSP00000154968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023809] [ENSMUST00000229278]
Predicted Effect probably benign
Transcript: ENSMUST00000023809
AA Change: Q402L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000023809
Gene: ENSMUSG00000023047
AA Change: Q402L

DomainStartEndE-ValueType
Pfam:Activin_recp 46 124 3.4e-7 PFAM
transmembrane domain 146 168 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
Pfam:Pkinase 199 501 4.6e-25 PFAM
Pfam:Pkinase_Tyr 199 501 2.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161376
Predicted Effect probably benign
Transcript: ENSMUST00000162893
SMART Domains Protein: ENSMUSP00000123735
Gene: ENSMUSG00000023047

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 3 73 2.4e-8 PFAM
Pfam:Pkinase 6 84 1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181328
Predicted Effect probably benign
Transcript: ENSMUST00000229278
AA Change: Q402L

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for the anti-Mullerian hormone (AMH) which, in addition to testosterone, results in male sex differentiation. AMH and testosterone are produced in the testes by different cells and have different effects. Testosterone promotes the development of male genitalia while the binding of AMH to the encoded receptor prevents the development of the mullerian ducts into uterus and Fallopian tubes. Mutations in this gene are associated with persistent Mullerian duct syndrome type II. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mutant males have a complete male reproductive tract, but also a uterus and oviducts. Functional sperm are produced, but most males are infertile because female reproductive organs block sperm transfer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akp3 G A 1: 87,127,871 G547R unknown Het
Brip1 A T 11: 86,064,937 L917M possibly damaging Het
Dennd5a G A 7: 109,921,334 R415* probably null Het
Eif2ak1 G T 5: 143,899,176 probably null Het
Golga4 G A 9: 118,548,784 A458T probably benign Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Ift88 C T 14: 57,517,019 R762* probably null Het
Kansl2 A T 15: 98,533,685 C28* probably null Het
Lct T C 1: 128,301,309 R816G probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Obscn T C 11: 59,028,943 N6809S probably null Het
Pak6 A G 2: 118,696,509 T662A probably benign Het
Pglyrp3 T C 3: 92,028,172 F243S probably benign Het
Rab44 T C 17: 29,140,461 V541A possibly damaging Het
Slc39a6 G T 18: 24,585,292 H569Q probably damaging Het
Slc4a7 T C 14: 14,733,832 S87P probably damaging Het
Spocd1 T C 4: 129,956,806 V875A possibly damaging Het
Tspan17 A G 13: 54,795,171 D146G probably damaging Het
Other mutations in Amhr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02273:Amhr2 APN 15 102452489 missense probably benign 0.02
IGL02941:Amhr2 APN 15 102447289 missense probably damaging 1.00
R0269:Amhr2 UTSW 15 102447068 missense probably benign 0.39
R0645:Amhr2 UTSW 15 102446428 missense probably damaging 1.00
R1857:Amhr2 UTSW 15 102446777 nonsense probably null
R3500:Amhr2 UTSW 15 102447066 missense probably benign 0.01
R3882:Amhr2 UTSW 15 102445898 missense probably damaging 1.00
R4661:Amhr2 UTSW 15 102454253 missense probably damaging 1.00
R4980:Amhr2 UTSW 15 102454330 missense probably benign 0.00
R5053:Amhr2 UTSW 15 102447258 missense probably damaging 1.00
R7003:Amhr2 UTSW 15 102446333 missense probably benign 0.00
R7016:Amhr2 UTSW 15 102454364 missense possibly damaging 0.63
R7293:Amhr2 UTSW 15 102447393 missense probably benign 0.00
R7636:Amhr2 UTSW 15 102452458 missense probably damaging 1.00
RF014:Amhr2 UTSW 15 102453154 missense probably benign 0.00
X0013:Amhr2 UTSW 15 102452752 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATAAGTGTGAGACCTGTGGTGACG -3'
(R):5'- TGCTGCCCAGTTCTGCCTCATAAG -3'

Sequencing Primer
(F):5'- TGGCTCTGATGACAGTACAAC -3'
(R):5'- TGTTAACCTACCCTGGCGAG -3'
Posted On2014-01-05