Incidental Mutation 'R1129:Ccdc73'
List |< first << previous [record 3 of 25] next >> last >|
ID96452
Institutional Source Beutler Lab
Gene Symbol Ccdc73
Ensembl Gene ENSMUSG00000045106
Gene Namecoiled-coil domain containing 73
Synonyms2210415I11Rik
MMRRC Submission 039202-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R1129 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location104867805-105017904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104992190 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 828 (N828S)
Ref Sequence ENSEMBL: ENSMUSP00000106743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111114] [ENSMUST00000151764]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111114
AA Change: N828S

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106743
Gene: ENSMUSG00000045106
AA Change: N828S

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:CCDC73 27 1061 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144358
SMART Domains Protein: ENSMUSP00000114374
Gene: ENSMUSG00000045106

DomainStartEndE-ValueType
Pfam:CCDC73 1 182 3.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151764
SMART Domains Protein: ENSMUSP00000120706
Gene: ENSMUSG00000045106

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
coiled coil region 48 134 N/A INTRINSIC
coiled coil region 178 381 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrm1 G C 2: 180,172,919 probably benign Het
Bub1b A T 2: 118,615,006 D269V probably damaging Het
Cdk12 T C 11: 98,245,375 S1152P unknown Het
Cnnm3 T C 1: 36,513,016 L369P probably damaging Het
Cxadr A G 16: 78,336,433 K360R probably benign Het
Dlg2 G A 7: 92,431,174 probably null Het
Dst T C 1: 34,199,554 V3779A probably benign Het
Fbxo16 G A 14: 65,295,532 R161K probably benign Het
Gm9726 T A 12: 93,928,526 noncoding transcript Het
Hectd4 A G 5: 121,310,599 T337A possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Ints1 A G 5: 139,758,471 L1510S probably benign Het
Kansl2 T C 15: 98,533,581 Y63C probably damaging Het
Lats2 T C 14: 57,700,333 E233G possibly damaging Het
Naca T C 10: 128,040,202 probably benign Het
Pprc1 G T 19: 46,063,806 A591S probably benign Het
Sbsn C T 7: 30,753,440 P627S probably benign Het
Sema6b T C 17: 56,124,347 E772G probably benign Het
Tmem33 A G 5: 67,264,460 probably null Het
Tmtc4 A G 14: 122,943,153 probably null Het
Ubqlnl A T 7: 104,149,650 H213Q probably damaging Het
Ugt1a10 T C 1: 88,055,609 M43T probably benign Het
Vmn2r68 T C 7: 85,237,504 probably null Het
Zcchc14 A G 8: 121,608,415 probably benign Het
Other mutations in Ccdc73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Ccdc73 APN 2 104994591 missense probably damaging 1.00
IGL01313:Ccdc73 APN 2 104907627 missense probably benign 0.00
IGL02016:Ccdc73 APN 2 104975616 missense probably benign 0.05
IGL02179:Ccdc73 APN 2 104907568 missense probably damaging 0.99
FR4304:Ccdc73 UTSW 2 104991840 unclassified probably benign
FR4737:Ccdc73 UTSW 2 104991840 unclassified probably benign
IGL03052:Ccdc73 UTSW 2 104951936 missense possibly damaging 0.78
R0010:Ccdc73 UTSW 2 104980987 splice site probably benign
R0040:Ccdc73 UTSW 2 104992084 missense probably damaging 1.00
R0052:Ccdc73 UTSW 2 104929570 splice site probably benign
R0360:Ccdc73 UTSW 2 104981007 missense probably damaging 1.00
R0401:Ccdc73 UTSW 2 104991289 missense probably benign 0.01
R0715:Ccdc73 UTSW 2 104973154 splice site probably benign
R0839:Ccdc73 UTSW 2 104991097 missense probably benign 0.05
R1240:Ccdc73 UTSW 2 104991561 missense probably benign 0.05
R1478:Ccdc73 UTSW 2 104907610 missense possibly damaging 0.72
R1478:Ccdc73 UTSW 2 104914667 missense possibly damaging 0.93
R1695:Ccdc73 UTSW 2 104992105 missense probably damaging 1.00
R1924:Ccdc73 UTSW 2 104992292 missense probably damaging 1.00
R1950:Ccdc73 UTSW 2 104926935 missense probably benign 0.01
R1987:Ccdc73 UTSW 2 104931045 nonsense probably null
R1987:Ccdc73 UTSW 2 104999159 missense probably damaging 1.00
R2938:Ccdc73 UTSW 2 104975635 nonsense probably null
R3420:Ccdc73 UTSW 2 104951947 missense probably null 1.00
R3420:Ccdc73 UTSW 2 104951948 splice site probably null
R3422:Ccdc73 UTSW 2 104951947 missense probably null 1.00
R3422:Ccdc73 UTSW 2 104951948 splice site probably null
R3522:Ccdc73 UTSW 2 104991485 missense probably damaging 1.00
R3886:Ccdc73 UTSW 2 104991343 missense possibly damaging 0.94
R4279:Ccdc73 UTSW 2 104985010 missense possibly damaging 0.87
R4791:Ccdc73 UTSW 2 104981105 splice site probably null
R4793:Ccdc73 UTSW 2 105017782 splice site probably null
R4939:Ccdc73 UTSW 2 104992157 splice site probably null
R4950:Ccdc73 UTSW 2 104992366 missense probably benign
R5093:Ccdc73 UTSW 2 105017766 utr 3 prime probably benign
R5150:Ccdc73 UTSW 2 104992039 missense probably benign 0.00
R5381:Ccdc73 UTSW 2 104989925 missense probably damaging 1.00
R5738:Ccdc73 UTSW 2 104930986 missense possibly damaging 0.78
R6148:Ccdc73 UTSW 2 104992137 missense possibly damaging 0.58
R6269:Ccdc73 UTSW 2 104907633 missense probably damaging 1.00
R6738:Ccdc73 UTSW 2 104992088 missense probably benign 0.00
R6753:Ccdc73 UTSW 2 104991524 nonsense probably null
R7062:Ccdc73 UTSW 2 104951878 missense probably damaging 1.00
R7110:Ccdc73 UTSW 2 104973224 missense probably benign 0.21
R7320:Ccdc73 UTSW 2 104999176 missense possibly damaging 0.47
R7436:Ccdc73 UTSW 2 104951869 missense probably damaging 1.00
R7530:Ccdc73 UTSW 2 104994570 missense
R7747:Ccdc73 UTSW 2 104929556 missense probably damaging 1.00
R7952:Ccdc73 UTSW 2 104945456 critical splice donor site probably null
R8178:Ccdc73 UTSW 2 104991212 missense probably benign 0.00
Z1177:Ccdc73 UTSW 2 104992239 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGACAGTCATACTTCACAAGCCAAAGG -3'
(R):5'- ATAAAGGGATGCTGGGCGTTGC -3'

Sequencing Primer
(F):5'- CACAAGCCAAAGGTTTGAAAACTG -3'
(R):5'- AGGGGTACAAACTTTATGTAGCCTG -3'
Posted On2014-01-05