Incidental Mutation 'R1017:Sik3'
Institutional Source Beutler Lab
Gene Symbol Sik3
Ensembl Gene ENSMUSG00000034135
Gene NameSIK family kinase 3
MMRRC Submission 039121-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1017 (G1)
Quality Score225
Status Validated
Chromosomal Location46012820-46224194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46195809 bp
Amino Acid Change Threonine to Isoleucine at position 417 (T417I)
Ref Sequence ENSEMBL: ENSMUSP00000112749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120463] [ENSMUST00000126865]
Predicted Effect unknown
Transcript: ENSMUST00000120247
AA Change: T323I
SMART Domains Protein: ENSMUSP00000112859
Gene: ENSMUSG00000034135
AA Change: T323I

S_TKc 19 270 5.4e-102 SMART
internal_repeat_1 349 392 8.97e-6 PROSPERO
low complexity region 436 445 N/A INTRINSIC
internal_repeat_1 492 536 8.97e-6 PROSPERO
low complexity region 602 613 N/A INTRINSIC
low complexity region 628 648 N/A INTRINSIC
low complexity region 682 693 N/A INTRINSIC
low complexity region 785 798 N/A INTRINSIC
low complexity region 891 906 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120463
AA Change: T417I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000112749
Gene: ENSMUSG00000034135
AA Change: T417I

low complexity region 1 53 N/A INTRINSIC
S_TKc 64 315 5.4e-102 SMART
low complexity region 529 538 N/A INTRINSIC
low complexity region 647 658 N/A INTRINSIC
low complexity region 673 693 N/A INTRINSIC
low complexity region 727 738 N/A INTRINSIC
low complexity region 830 843 N/A INTRINSIC
low complexity region 894 907 N/A INTRINSIC
low complexity region 996 1011 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000122865
AA Change: T321I
SMART Domains Protein: ENSMUSP00000115981
Gene: ENSMUSG00000034135
AA Change: T321I

S_TKc 1 220 3.32e-70 SMART
low complexity region 434 443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126865
AA Change: T419I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000121032
Gene: ENSMUSG00000034135
AA Change: T419I

low complexity region 2 55 N/A INTRINSIC
S_TKc 66 317 5.4e-102 SMART
internal_repeat_1 444 487 1.55e-6 PROSPERO
low complexity region 531 540 N/A INTRINSIC
internal_repeat_1 587 631 1.55e-6 PROSPERO
low complexity region 697 708 N/A INTRINSIC
low complexity region 723 743 N/A INTRINSIC
low complexity region 777 788 N/A INTRINSIC
low complexity region 880 893 N/A INTRINSIC
low complexity region 944 957 N/A INTRINSIC
low complexity region 1046 1061 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153152
Meta Mutation Damage Score 0.1132 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired chondrocyte hypertrophy during development, neonatal lethality and reduced size. Mice homozygous for a gain of function ENU mutation exhibit decreased total wake time, owing to an increase in inherent sleep need. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp C T 6: 125,061,260 probably benign Het
Ahnak A T 19: 9,010,543 I3064F probably damaging Het
Arhgef10l C A 4: 140,515,306 R884L probably damaging Het
Baiap2l2 A G 15: 79,261,243 F317L probably benign Het
Brinp2 A T 1: 158,249,451 I358N probably damaging Het
Ccin A G 4: 43,985,222 D543G probably benign Het
Cdh23 T A 10: 60,331,793 D1806V probably damaging Het
Cdh6 C T 15: 13,051,476 R357Q probably benign Het
Cpa3 T C 3: 20,239,633 M64V possibly damaging Het
Ctnnb1 T A 9: 120,950,728 F74I probably damaging Het
Cyp7a1 A T 4: 6,272,307 I302N probably damaging Het
Dnase1l2 C T 17: 24,442,472 A56T probably benign Het
Dscam T A 16: 96,833,433 D190V probably damaging Het
Fer1l4 T C 2: 156,049,478 probably null Het
Fscb T A 12: 64,473,468 D408V probably benign Het
Gm10306 A G 4: 94,556,720 probably benign Het
Gon4l T A 3: 88,858,496 M409K probably benign Het
Gsx2 T C 5: 75,077,262 S292P probably damaging Het
Hira T A 16: 18,899,347 probably null Het
Hoxa3 G T 6: 52,172,406 probably null Het
Irak3 T C 10: 120,142,884 E554G possibly damaging Het
Itgb3bp A G 4: 99,769,487 probably benign Het
Kifc3 C T 8: 95,105,785 D379N probably damaging Het
Lama5 A G 2: 180,195,420 V1032A probably damaging Het
Lmln T G 16: 33,088,176 I324R probably benign Het
Ltbp4 A G 7: 27,306,076 S1547P possibly damaging Het
Mdga1 T A 17: 29,850,548 T175S probably damaging Het
Mrps6 T A 16: 92,058,458 L8* probably null Het
Mtmr11 A C 3: 96,164,477 T203P probably damaging Het
Nat8f7 T C 6: 85,707,570 D96G probably damaging Het
Obscn T C 11: 58,998,353 E7531G unknown Het
Olfr1061 A T 2: 86,413,511 D180E probably damaging Het
Olfr1065 A T 2: 86,445,428 L185I probably benign Het
Olfr267 A T 4: 58,785,115 S202R probably damaging Het
Osbpl6 A G 2: 76,549,719 Y69C probably damaging Het
Polrmt C T 10: 79,743,509 W136* probably null Het
Raver1 T C 9: 21,079,590 probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rsl1d1 T C 16: 11,203,252 K2E probably benign Het
Spdl1 T C 11: 34,819,290 K388R possibly damaging Het
Tulp1 T C 17: 28,364,303 R88G probably damaging Het
Vldlr A C 19: 27,241,333 Y528S probably damaging Het
Zdhhc14 T A 17: 5,493,649 L68H probably damaging Het
Zfp605 C T 5: 110,127,994 T326I probably benign Het
Other mutations in Sik3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01569:Sik3 APN 9 46211726 missense probably benign 0.37
IGL02957:Sik3 APN 9 46195845 missense possibly damaging 0.90
IGL03052:Sik3 UTSW 9 46198149 missense probably damaging 0.97
PIT4515001:Sik3 UTSW 9 46208731 missense probably damaging 1.00
R0119:Sik3 UTSW 9 46208740 missense possibly damaging 0.81
R0299:Sik3 UTSW 9 46208740 missense possibly damaging 0.81
R0344:Sik3 UTSW 9 46208811 missense probably damaging 0.97
R0411:Sik3 UTSW 9 46208770 missense probably damaging 0.99
R0499:Sik3 UTSW 9 46208740 missense possibly damaging 0.81
R0745:Sik3 UTSW 9 46198239 missense probably benign 0.10
R1310:Sik3 UTSW 9 46219426 missense possibly damaging 0.81
R1355:Sik3 UTSW 9 46195872 critical splice donor site probably benign
R1406:Sik3 UTSW 9 46123345 splice site probably benign
R1457:Sik3 UTSW 9 46221148 missense probably damaging 1.00
R1497:Sik3 UTSW 9 46202022 missense probably damaging 1.00
R1497:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1852:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1883:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1884:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1903:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1918:Sik3 UTSW 9 46221089 missense probably benign 0.00
R2077:Sik3 UTSW 9 46219503 missense probably damaging 1.00
R2379:Sik3 UTSW 9 46155409 missense probably damaging 1.00
R3791:Sik3 UTSW 9 46194822 missense possibly damaging 0.94
R3809:Sik3 UTSW 9 46219486 missense probably benign 0.05
R3955:Sik3 UTSW 9 46198593 missense probably damaging 1.00
R3980:Sik3 UTSW 9 46202063 missense probably damaging 1.00
R4753:Sik3 UTSW 9 46198214 missense probably damaging 0.99
R5195:Sik3 UTSW 9 46208844 critical splice donor site probably null
R5256:Sik3 UTSW 9 46212254 missense probably damaging 0.99
R5432:Sik3 UTSW 9 46123241 missense probably benign 0.45
R5985:Sik3 UTSW 9 46211675 missense probably damaging 1.00
R6310:Sik3 UTSW 9 46178486 missense probably damaging 1.00
R6540:Sik3 UTSW 9 46212053 missense probably benign
R6732:Sik3 UTSW 9 46212553 missense probably benign 0.02
R6812:Sik3 UTSW 9 46210769 missense probably damaging 1.00
R7069:Sik3 UTSW 9 46210743 missense probably damaging 1.00
R7830:Sik3 UTSW 9 46212057 small deletion probably benign
R7875:Sik3 UTSW 9 46123230 missense probably damaging 1.00
R7958:Sik3 UTSW 9 46123230 missense probably damaging 1.00
X0017:Sik3 UTSW 9 46212499 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cctagccattgggaatctgag -3'
Posted On2014-01-05