Incidental Mutation 'R1129:Bub1b'
List |< first << previous [record 2 of 25] next >> last >|
Institutional Source Beutler Lab
Gene Symbol Bub1b
Ensembl Gene ENSMUSG00000040084
Gene NameBUB1B, mitotic checkpoint serine/threonine kinase
MMRRC Submission 039202-MU
Accession Numbers

NM_009773; MGI: 1333889

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1129 (G1)
Quality Score225
Status Not validated
Chromosomal Location118598211-118641591 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118615006 bp
Amino Acid Change Aspartic acid to Valine at position 269 (D269V)
Ref Sequence ENSEMBL: ENSMUSP00000037126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038341]
Predicted Effect probably damaging
Transcript: ENSMUST00000038341
AA Change: D269V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037126
Gene: ENSMUSG00000040084
AA Change: D269V

PDB:4GGD|D 14 35 6e-6 PDB
Mad3_BUB1_I 49 173 1.83e-68 SMART
low complexity region 198 214 N/A INTRINSIC
low complexity region 382 395 N/A INTRINSIC
coiled coil region 418 457 N/A INTRINSIC
low complexity region 671 686 N/A INTRINSIC
low complexity region 717 726 N/A INTRINSIC
Pfam:Pkinase 806 942 4.5e-7 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinase involved in spindle checkpoint function. The protein has been localized to the kinetochore and plays a role in the inhibition of the anaphase-promoting complex/cyclosome (APC/C), delaying the onset of anaphase and ensuring proper chromosome segregation. Impaired spindle checkpoint function has been found in many forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant embryos undergo extensive apoptosis and die during early gestation. Heterozygous mice are viable and exhibit splenomegaly, abnormal megakaryopoiesis, and an increased susceptibility to intestinal tumorigenesis. Hypomorphic homozygotes display infertility and premature aging. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(18)

Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrm1 G C 2: 180,172,919 probably benign Het
Ccdc73 A G 2: 104,992,190 N828S possibly damaging Het
Cdk12 T C 11: 98,245,375 S1152P unknown Het
Cnnm3 T C 1: 36,513,016 L369P probably damaging Het
Cxadr A G 16: 78,336,433 K360R probably benign Het
Dlg2 G A 7: 92,431,174 probably null Het
Dst T C 1: 34,199,554 V3779A probably benign Het
Fbxo16 G A 14: 65,295,532 R161K probably benign Het
Gm9726 T A 12: 93,928,526 noncoding transcript Het
Hectd4 A G 5: 121,310,599 T337A possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Ints1 A G 5: 139,758,471 L1510S probably benign Het
Kansl2 T C 15: 98,533,581 Y63C probably damaging Het
Lats2 T C 14: 57,700,333 E233G possibly damaging Het
Naca T C 10: 128,040,202 probably benign Het
Pprc1 G T 19: 46,063,806 A591S probably benign Het
Sbsn C T 7: 30,753,440 P627S probably benign Het
Sema6b T C 17: 56,124,347 E772G probably benign Het
Tmem33 A G 5: 67,264,460 probably null Het
Tmtc4 A G 14: 122,943,153 probably null Het
Ubqlnl A T 7: 104,149,650 H213Q probably damaging Het
Ugt1a10 T C 1: 88,055,609 M43T probably benign Het
Vmn2r68 T C 7: 85,237,504 probably null Het
Zcchc14 A G 8: 121,608,415 probably benign Het
Other mutations in Bub1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Bub1b APN 2 118630138 missense probably benign
IGL01319:Bub1b APN 2 118614994 missense possibly damaging 0.49
IGL01744:Bub1b APN 2 118636749 missense probably damaging 0.99
IGL03184:Bub1b APN 2 118609777 splice site probably benign
P0035:Bub1b UTSW 2 118622185 missense probably damaging 1.00
R0315:Bub1b UTSW 2 118626976 splice site probably benign
R0322:Bub1b UTSW 2 118639618 splice site probably benign
R0378:Bub1b UTSW 2 118641123 missense probably benign 0.01
R0457:Bub1b UTSW 2 118609859 missense probably damaging 1.00
R0845:Bub1b UTSW 2 118609976 missense probably damaging 1.00
R0960:Bub1b UTSW 2 118606680 missense probably benign 0.03
R1071:Bub1b UTSW 2 118632447 frame shift probably null
R1138:Bub1b UTSW 2 118623089 missense probably benign 0.01
R1171:Bub1b UTSW 2 118606686 missense probably benign 0.31
R1613:Bub1b UTSW 2 118639741 critical splice donor site probably null
R1667:Bub1b UTSW 2 118641189 missense probably benign 0.00
R1812:Bub1b UTSW 2 118632421 missense probably benign 0.00
R1828:Bub1b UTSW 2 118638439 missense probably benign 0.00
R2085:Bub1b UTSW 2 118622195 missense possibly damaging 0.88
R2137:Bub1b UTSW 2 118636718 nonsense probably null
R3749:Bub1b UTSW 2 118615455 missense possibly damaging 0.63
R3750:Bub1b UTSW 2 118615455 missense possibly damaging 0.63
R4211:Bub1b UTSW 2 118630978 missense possibly damaging 0.78
R4579:Bub1b UTSW 2 118623176 nonsense probably null
R4993:Bub1b UTSW 2 118636770 missense possibly damaging 0.63
R5144:Bub1b UTSW 2 118615499 missense possibly damaging 0.92
R5229:Bub1b UTSW 2 118629989 missense probably damaging 1.00
R5596:Bub1b UTSW 2 118630982 missense probably damaging 1.00
R5656:Bub1b UTSW 2 118605431 missense probably damaging 1.00
R5785:Bub1b UTSW 2 118609844 missense probably damaging 0.98
R5883:Bub1b UTSW 2 118609882 missense probably damaging 1.00
R6128:Bub1b UTSW 2 118617812 missense probably benign
R6187:Bub1b UTSW 2 118631000 missense probably damaging 1.00
R6333:Bub1b UTSW 2 118598463 critical splice donor site probably null
R6985:Bub1b UTSW 2 118606614 missense probably damaging 1.00
R6988:Bub1b UTSW 2 118636830 missense probably damaging 0.96
R7161:Bub1b UTSW 2 118626053 missense probably damaging 1.00
R7341:Bub1b UTSW 2 118636786 missense possibly damaging 0.95
R7575:Bub1b UTSW 2 118641158 missense possibly damaging 0.51
R7824:Bub1b UTSW 2 118626967 splice site probably null
R8129:Bub1b UTSW 2 118638494 missense probably benign 0.06
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tgagagcccatatcaaacacac -3'
Posted On2014-01-05