Incidental Mutation 'R1017:Irak3'
ID96466
Institutional Source Beutler Lab
Gene Symbol Irak3
Ensembl Gene ENSMUSG00000020227
Gene Nameinterleukin-1 receptor-associated kinase 3
Synonyms4833428C18Rik, IRAK-M
MMRRC Submission 039121-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock #R1017 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location120141648-120202130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120142884 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 554 (E554G)
Ref Sequence ENSEMBL: ENSMUSP00000020448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020448] [ENSMUST00000135106] [ENSMUST00000145665]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020448
AA Change: E554G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020448
Gene: ENSMUSG00000020227
AA Change: E554G

DomainStartEndE-ValueType
Pfam:Death 26 106 1.3e-15 PFAM
Pfam:Pkinase 178 456 8.4e-37 PFAM
Pfam:Pkinase_Tyr 178 456 2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135106
SMART Domains Protein: ENSMUSP00000123604
Gene: ENSMUSG00000020227

DomainStartEndE-ValueType
Pfam:Death 26 106 2.2e-16 PFAM
Pfam:Pkinase_Tyr 178 301 3.1e-15 PFAM
Pfam:Pkinase 178 302 4.9e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000145665
AA Change: E462G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118038
Gene: ENSMUSG00000020227
AA Change: E462G

DomainStartEndE-ValueType
Pfam:Pkinase 86 364 8.4e-35 PFAM
Pfam:Pkinase_Tyr 86 364 1.7e-34 PFAM
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the interleukin-1 receptor-associated kinase protein family. Members of this family are essential components of the Toll/IL-R immune signal transduction pathways. This protein is primarily expressed in monocytes and macrophages and functions as a negative regulator of Toll-like receptor signaling. Mutations in this gene are associated with a susceptibility to asthma. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormal inflammatory responses to bacterial infections and loose bone mass with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp C T 6: 125,061,260 probably benign Het
Ahnak A T 19: 9,010,543 I3064F probably damaging Het
Arhgef10l C A 4: 140,515,306 R884L probably damaging Het
Baiap2l2 A G 15: 79,261,243 F317L probably benign Het
Brinp2 A T 1: 158,249,451 I358N probably damaging Het
Ccin A G 4: 43,985,222 D543G probably benign Het
Cdh23 T A 10: 60,331,793 D1806V probably damaging Het
Cdh6 C T 15: 13,051,476 R357Q probably benign Het
Cpa3 T C 3: 20,239,633 M64V possibly damaging Het
Ctnnb1 T A 9: 120,950,728 F74I probably damaging Het
Cyp7a1 A T 4: 6,272,307 I302N probably damaging Het
Dnase1l2 C T 17: 24,442,472 A56T probably benign Het
Dscam T A 16: 96,833,433 D190V probably damaging Het
Fer1l4 T C 2: 156,049,478 probably null Het
Fscb T A 12: 64,473,468 D408V probably benign Het
Gm10306 A G 4: 94,556,720 probably benign Het
Gon4l T A 3: 88,858,496 M409K probably benign Het
Gsx2 T C 5: 75,077,262 S292P probably damaging Het
Hira T A 16: 18,899,347 probably null Het
Hoxa3 G T 6: 52,172,406 probably null Het
Itgb3bp A G 4: 99,769,487 probably benign Het
Kifc3 C T 8: 95,105,785 D379N probably damaging Het
Lama5 A G 2: 180,195,420 V1032A probably damaging Het
Lmln T G 16: 33,088,176 I324R probably benign Het
Ltbp4 A G 7: 27,306,076 S1547P possibly damaging Het
Mdga1 T A 17: 29,850,548 T175S probably damaging Het
Mrps6 T A 16: 92,058,458 L8* probably null Het
Mtmr11 A C 3: 96,164,477 T203P probably damaging Het
Nat8f7 T C 6: 85,707,570 D96G probably damaging Het
Obscn T C 11: 58,998,353 E7531G unknown Het
Olfr1061 A T 2: 86,413,511 D180E probably damaging Het
Olfr1065 A T 2: 86,445,428 L185I probably benign Het
Olfr267 A T 4: 58,785,115 S202R probably damaging Het
Osbpl6 A G 2: 76,549,719 Y69C probably damaging Het
Polrmt C T 10: 79,743,509 W136* probably null Het
Raver1 T C 9: 21,079,590 probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rsl1d1 T C 16: 11,203,252 K2E probably benign Het
Sik3 C T 9: 46,195,809 T417I probably benign Het
Spdl1 T C 11: 34,819,290 K388R possibly damaging Het
Tulp1 T C 17: 28,364,303 R88G probably damaging Het
Vldlr A C 19: 27,241,333 Y528S probably damaging Het
Zdhhc14 T A 17: 5,493,649 L68H probably damaging Het
Zfp605 C T 5: 110,127,994 T326I probably benign Het
Other mutations in Irak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Irak3 APN 10 120178067 critical splice donor site probably null
IGL01015:Irak3 APN 10 120142790 nonsense probably null
IGL01530:Irak3 APN 10 120142794 missense probably benign 0.10
IGL01641:Irak3 APN 10 120176347 missense probably benign 0.35
IGL01730:Irak3 APN 10 120178100 missense probably benign 0.04
IGL02054:Irak3 APN 10 120176259 missense probably benign 0.01
IGL02938:Irak3 APN 10 120182524 critical splice donor site probably null
IGL02954:Irak3 APN 10 120176242 missense probably damaging 0.98
IGL02992:Irak3 APN 10 120182661 missense probably damaging 1.00
IGL03376:Irak3 APN 10 120146636 splice site probably benign
iracema UTSW 10 120145782 missense probably damaging 0.99
R0031:Irak3 UTSW 10 120176320 nonsense probably null
R0734:Irak3 UTSW 10 120145637 splice site probably benign
R1025:Irak3 UTSW 10 120176346 missense probably damaging 1.00
R1486:Irak3 UTSW 10 120143061 missense probably damaging 1.00
R1538:Irak3 UTSW 10 120165130 missense probably benign 0.00
R1596:Irak3 UTSW 10 120182546 missense probably damaging 1.00
R1689:Irak3 UTSW 10 120146552 missense probably damaging 0.98
R2133:Irak3 UTSW 10 120165177 missense probably benign 0.10
R3609:Irak3 UTSW 10 120145677 missense possibly damaging 0.95
R3947:Irak3 UTSW 10 120170373 missense probably benign 0.00
R3948:Irak3 UTSW 10 120170373 missense probably benign 0.00
R4510:Irak3 UTSW 10 120145908 missense probably damaging 0.99
R4511:Irak3 UTSW 10 120145908 missense probably damaging 0.99
R4885:Irak3 UTSW 10 120182681 missense probably damaging 1.00
R5007:Irak3 UTSW 10 120146429 critical splice donor site probably null
R5180:Irak3 UTSW 10 120145782 missense probably damaging 0.99
R5704:Irak3 UTSW 10 120145689 missense probably benign 0.04
R5715:Irak3 UTSW 10 120142736 missense possibly damaging 0.66
R6020:Irak3 UTSW 10 120143137 missense probably damaging 1.00
R6916:Irak3 UTSW 10 120201365 missense probably damaging 1.00
R7182:Irak3 UTSW 10 120166511 missense probably damaging 1.00
R7707:Irak3 UTSW 10 120146584 missense probably damaging 0.99
R7787:Irak3 UTSW 10 120176351 missense probably benign 0.06
X0023:Irak3 UTSW 10 120143187 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTCAGTGCCTTCAGTGACG -3'
(R):5'- AGCACCCAGCCTAGCTTGTATTTTG -3'

Sequencing Primer
(F):5'- GCCTTCAGTGACGTTTGC -3'
(R):5'- GTCCCAAGTATTCCAGTAGAAGATG -3'
Posted On2014-01-05