Incidental Mutation 'R1129:Tmem33'
List |< first << previous [record 20 of 25] next >> last >|
Institutional Source Beutler Lab
Gene Symbol Tmem33
Ensembl Gene ENSMUSG00000037720
Gene Nametransmembrane protein 33
Synonyms2700052H22Rik, 5430406L04Rik, 1110006G02Rik, 1600019D15Rik, 2410089A21Rik
MMRRC Submission 039202-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R1129 (G1)
Quality Score225
Status Not validated
Chromosomal Location67260565-67291461 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 67264460 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037918] [ENSMUST00000160352] [ENSMUST00000161233] [ENSMUST00000161233] [ENSMUST00000161369] [ENSMUST00000162074] [ENSMUST00000162543] [ENSMUST00000201979]
Predicted Effect probably null
Transcript: ENSMUST00000037918
SMART Domains Protein: ENSMUSP00000042852
Gene: ENSMUSG00000037720

Pfam:UPF0121 1 247 9.8e-126 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000160352
SMART Domains Protein: ENSMUSP00000124766
Gene: ENSMUSG00000037720

Pfam:UPF0121 1 246 2.8e-126 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161233
Predicted Effect probably null
Transcript: ENSMUST00000161233
Predicted Effect probably null
Transcript: ENSMUST00000161369
SMART Domains Protein: ENSMUSP00000124390
Gene: ENSMUSG00000037720

Pfam:UPF0121 7 245 1.8e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162074
Predicted Effect probably benign
Transcript: ENSMUST00000162543
AA Change: I111V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124765
Gene: ENSMUSG00000037720
AA Change: I111V

Pfam:UPF0121 1 119 2.1e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201816
Predicted Effect probably benign
Transcript: ENSMUST00000201979
SMART Domains Protein: ENSMUSP00000144531
Gene: ENSMUSG00000037720

Pfam:UPF0121 7 61 5.9e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202324
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrm1 G C 2: 180,172,919 probably benign Het
Bub1b A T 2: 118,615,006 D269V probably damaging Het
Ccdc73 A G 2: 104,992,190 N828S possibly damaging Het
Cdk12 T C 11: 98,245,375 S1152P unknown Het
Cnnm3 T C 1: 36,513,016 L369P probably damaging Het
Cxadr A G 16: 78,336,433 K360R probably benign Het
Dlg2 G A 7: 92,431,174 probably null Het
Dst T C 1: 34,199,554 V3779A probably benign Het
Fbxo16 G A 14: 65,295,532 R161K probably benign Het
Gm9726 T A 12: 93,928,526 noncoding transcript Het
Hectd4 A G 5: 121,310,599 T337A possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Ints1 A G 5: 139,758,471 L1510S probably benign Het
Kansl2 T C 15: 98,533,581 Y63C probably damaging Het
Lats2 T C 14: 57,700,333 E233G possibly damaging Het
Naca T C 10: 128,040,202 probably benign Het
Pprc1 G T 19: 46,063,806 A591S probably benign Het
Sbsn C T 7: 30,753,440 P627S probably benign Het
Sema6b T C 17: 56,124,347 E772G probably benign Het
Tmtc4 A G 14: 122,943,153 probably null Het
Ubqlnl A T 7: 104,149,650 H213Q probably damaging Het
Ugt1a10 T C 1: 88,055,609 M43T probably benign Het
Vmn2r68 T C 7: 85,237,504 probably null Het
Zcchc14 A G 8: 121,608,415 probably benign Het
Other mutations in Tmem33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Tmem33 APN 5 67284195 missense probably damaging 1.00
IGL02076:Tmem33 APN 5 67286103 missense probably damaging 1.00
IGL03106:Tmem33 APN 5 67263796 missense probably damaging 1.00
commonplace UTSW 5 67264459 critical splice donor site probably null
R0573:Tmem33 UTSW 5 67264260 intron probably benign
R0839:Tmem33 UTSW 5 67264308 missense probably damaging 1.00
R1438:Tmem33 UTSW 5 67267291 splice site probably null
R1692:Tmem33 UTSW 5 67268554 missense probably null 0.57
R4513:Tmem33 UTSW 5 67286125 missense probably benign 0.02
R4763:Tmem33 UTSW 5 67286136 missense probably benign 0.22
R6298:Tmem33 UTSW 5 67268551 nonsense probably null
R6673:Tmem33 UTSW 5 67286125 missense probably benign 0.02
R6813:Tmem33 UTSW 5 67264459 critical splice donor site probably null
R7186:Tmem33 UTSW 5 67263787 missense possibly damaging 0.68
R7378:Tmem33 UTSW 5 67286133 missense probably benign
R8402:Tmem33 UTSW 5 67267375 splice site probably benign
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ttccatcacccacacagtag -3'
Posted On2014-01-05