Incidental Mutation 'R1129:Hectd4'
ID 96475
Institutional Source Beutler Lab
Gene Symbol Hectd4
Ensembl Gene ENSMUSG00000042744
Gene Name HECT domain E3 ubiquitin protein ligase 4
Synonyms Gm15800
MMRRC Submission 039202-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock # R1129 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 121220219-121368577 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121310599 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 337 (T337A)
Ref Sequence ENSEMBL: ENSMUSP00000098332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042614] [ENSMUST00000100769]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000042614
AA Change: T1674A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744
AA Change: T1674A

low complexity region 224 234 N/A INTRINSIC
low complexity region 266 282 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 725 735 N/A INTRINSIC
low complexity region 1252 1265 N/A INTRINSIC
coiled coil region 1372 1398 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1725 1741 N/A INTRINSIC
low complexity region 1892 1904 N/A INTRINSIC
low complexity region 2656 2666 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
low complexity region 2901 2917 N/A INTRINSIC
low complexity region 2921 2933 N/A INTRINSIC
low complexity region 3232 3246 N/A INTRINSIC
low complexity region 3275 3335 N/A INTRINSIC
low complexity region 3441 3448 N/A INTRINSIC
low complexity region 3473 3506 N/A INTRINSIC
low complexity region 3512 3533 N/A INTRINSIC
low complexity region 3540 3554 N/A INTRINSIC
low complexity region 3794 3822 N/A INTRINSIC
HECTc 4048 4412 4.78e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100769
AA Change: T337A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000098332
Gene: ENSMUSG00000042744
AA Change: T337A

coiled coil region 35 61 N/A INTRINSIC
low complexity region 214 225 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
low complexity region 555 567 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrm1 G C 2: 180,172,919 probably benign Het
Bub1b A T 2: 118,615,006 D269V probably damaging Het
Ccdc73 A G 2: 104,992,190 N828S possibly damaging Het
Cdk12 T C 11: 98,245,375 S1152P unknown Het
Cnnm3 T C 1: 36,513,016 L369P probably damaging Het
Cxadr A G 16: 78,336,433 K360R probably benign Het
Dlg2 G A 7: 92,431,174 probably null Het
Dst T C 1: 34,199,554 V3779A probably benign Het
Fbxo16 G A 14: 65,295,532 R161K probably benign Het
Gm9726 T A 12: 93,928,526 noncoding transcript Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Ints1 A G 5: 139,758,471 L1510S probably benign Het
Kansl2 T C 15: 98,533,581 Y63C probably damaging Het
Lats2 T C 14: 57,700,333 E233G possibly damaging Het
Naca T C 10: 128,040,202 probably benign Het
Pprc1 G T 19: 46,063,806 A591S probably benign Het
Sbsn C T 7: 30,753,440 P627S probably benign Het
Sema6b T C 17: 56,124,347 E772G probably benign Het
Tmem33 A G 5: 67,264,460 probably null Het
Tmtc4 A G 14: 122,943,153 probably null Het
Ubqlnl A T 7: 104,149,650 H213Q probably damaging Het
Ugt1a10 T C 1: 88,055,609 M43T probably benign Het
Vmn2r68 T C 7: 85,237,504 probably null Het
Zcchc14 A G 8: 121,608,415 probably benign Het
Other mutations in Hectd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Hectd4 APN 5 121363870 missense possibly damaging 0.51
IGL00976:Hectd4 APN 5 121349106 missense probably benign 0.18
IGL01085:Hectd4 APN 5 121331701 missense probably damaging 1.00
IGL01112:Hectd4 APN 5 121306950 missense probably benign 0.01
IGL01402:Hectd4 APN 5 121339417 splice site probably benign
IGL01474:Hectd4 APN 5 121336649 missense possibly damaging 0.53
IGL01503:Hectd4 APN 5 121318651 missense probably benign 0.28
IGL01548:Hectd4 APN 5 121364660 missense possibly damaging 0.71
IGL01656:Hectd4 APN 5 121322700 missense probably damaging 0.99
IGL01756:Hectd4 APN 5 121344824 missense probably benign 0.28
IGL01819:Hectd4 APN 5 121328418 missense possibly damaging 0.85
IGL02080:Hectd4 APN 5 121366606 utr 3 prime probably benign
IGL02488:Hectd4 APN 5 121292087 missense probably benign 0.33
IGL02490:Hectd4 APN 5 121318613 missense possibly damaging 0.82
IGL02558:Hectd4 APN 5 121344785 missense probably benign 0.28
IGL02626:Hectd4 APN 5 121353881 missense possibly damaging 0.86
IGL02649:Hectd4 APN 5 121349402 missense possibly damaging 0.73
IGL02736:Hectd4 APN 5 121342719 missense possibly damaging 0.73
IGL02861:Hectd4 APN 5 121307004 missense possibly damaging 0.81
IGL02880:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02889:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02953:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02969:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL03031:Hectd4 APN 5 121348794 missense possibly damaging 0.96
IGL03066:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL03160:Hectd4 APN 5 121259879 missense probably benign
IGL03181:Hectd4 APN 5 121353958 missense possibly damaging 0.91
IGL03265:Hectd4 APN 5 121259939 splice site probably benign
IGL03375:Hectd4 APN 5 121328382 missense possibly damaging 0.72
Achilles UTSW 5 121307381 nonsense probably null
agamemnon UTSW 5 121253858 splice site probably benign
clymnestra UTSW 5 121334375 missense possibly damaging 0.86
hector UTSW 5 121315437 missense probably damaging 1.00
helen UTSW 5 121310663 missense probably damaging 0.97
Merriwether UTSW 5 121353551 missense possibly damaging 0.53
PIT4466001:Hectd4 UTSW 5 121333060 critical splice donor site probably null
R0018:Hectd4 UTSW 5 121254179 missense possibly damaging 0.53
R0024:Hectd4 UTSW 5 121308576 missense possibly damaging 0.92
R0030:Hectd4 UTSW 5 121262588 nonsense probably null
R0080:Hectd4 UTSW 5 121349372 missense probably benign 0.18
R0110:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0110:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0115:Hectd4 UTSW 5 121295506 splice site probably benign
R0128:Hectd4 UTSW 5 121349243 missense possibly damaging 0.86
R0131:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0131:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0132:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0244:Hectd4 UTSW 5 121329605 missense probably benign 0.33
R0281:Hectd4 UTSW 5 121254251 missense possibly damaging 0.85
R0329:Hectd4 UTSW 5 121259864 missense probably benign
R0410:Hectd4 UTSW 5 121286266 missense possibly damaging 0.86
R0422:Hectd4 UTSW 5 121343082 splice site probably null
R0442:Hectd4 UTSW 5 121323982 missense possibly damaging 0.66
R0449:Hectd4 UTSW 5 121364590 splice site probably null
R0469:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0469:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0481:Hectd4 UTSW 5 121295506 splice site probably benign
R0510:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0510:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0520:Hectd4 UTSW 5 121331707 missense possibly damaging 0.53
R0534:Hectd4 UTSW 5 121348476 missense possibly damaging 0.96
R0603:Hectd4 UTSW 5 121304337 missense possibly damaging 0.46
R0617:Hectd4 UTSW 5 121343232 splice site probably benign
R0622:Hectd4 UTSW 5 121348625 missense possibly damaging 0.53
R0626:Hectd4 UTSW 5 121277824 missense probably benign 0.18
R0708:Hectd4 UTSW 5 121286463 critical splice donor site probably null
R0710:Hectd4 UTSW 5 121336628 missense probably benign 0.08
R0763:Hectd4 UTSW 5 121307033 unclassified probably benign
R0764:Hectd4 UTSW 5 121286769 missense possibly damaging 0.46
R1123:Hectd4 UTSW 5 121286736 missense probably damaging 0.96
R1204:Hectd4 UTSW 5 121350485 missense possibly damaging 0.85
R1237:Hectd4 UTSW 5 121321507 missense possibly damaging 0.90
R1257:Hectd4 UTSW 5 121318624 nonsense probably null
R1391:Hectd4 UTSW 5 121353695 missense possibly damaging 0.96
R1395:Hectd4 UTSW 5 121328513 critical splice donor site probably null
R1468:Hectd4 UTSW 5 121349172 missense possibly damaging 0.65
R1468:Hectd4 UTSW 5 121349172 missense possibly damaging 0.65
R1545:Hectd4 UTSW 5 121323956 missense possibly damaging 0.87
R1553:Hectd4 UTSW 5 121349259 missense probably benign 0.00
R1572:Hectd4 UTSW 5 121301878 missense possibly damaging 0.85
R1662:Hectd4 UTSW 5 121317245 missense probably benign 0.01
R1705:Hectd4 UTSW 5 121298104 missense probably benign
R1715:Hectd4 UTSW 5 121344818 missense possibly damaging 0.85
R1728:Hectd4 UTSW 5 121301839 missense possibly damaging 0.51
R1736:Hectd4 UTSW 5 121349530 missense possibly damaging 0.53
R1768:Hectd4 UTSW 5 121358303 missense possibly damaging 0.70
R1775:Hectd4 UTSW 5 121291191 splice site probably benign
R1784:Hectd4 UTSW 5 121301839 missense possibly damaging 0.51
R1843:Hectd4 UTSW 5 121297180 missense possibly damaging 0.53
R1914:Hectd4 UTSW 5 121322294 missense probably benign 0.08
R1915:Hectd4 UTSW 5 121322294 missense probably benign 0.08
R2024:Hectd4 UTSW 5 121281918 missense possibly damaging 0.86
R2103:Hectd4 UTSW 5 121355629 missense probably benign 0.04
R2108:Hectd4 UTSW 5 121333424 missense possibly damaging 0.72
R2124:Hectd4 UTSW 5 121318639 missense probably damaging 0.97
R2150:Hectd4 UTSW 5 121253858 splice site probably benign
R2192:Hectd4 UTSW 5 121315143 missense possibly damaging 0.46
R2301:Hectd4 UTSW 5 121353537 missense probably benign 0.18
R2324:Hectd4 UTSW 5 121315437 missense probably damaging 1.00
R2331:Hectd4 UTSW 5 121320026 missense probably benign 0.05
R2504:Hectd4 UTSW 5 121220620 missense unknown
R2504:Hectd4 UTSW 5 121263967 missense possibly damaging 0.73
R2904:Hectd4 UTSW 5 121292724 splice site probably benign
R3843:Hectd4 UTSW 5 121259873 missense possibly damaging 0.72
R3934:Hectd4 UTSW 5 121320101 critical splice donor site probably null
R3944:Hectd4 UTSW 5 121303525 splice site probably benign
R4133:Hectd4 UTSW 5 121277834 critical splice donor site probably null
R4271:Hectd4 UTSW 5 121220504 small deletion probably benign
R4413:Hectd4 UTSW 5 121350481 missense possibly damaging 0.53
R4456:Hectd4 UTSW 5 121308271 missense possibly damaging 0.65
R4489:Hectd4 UTSW 5 121286257 missense possibly damaging 0.73
R4539:Hectd4 UTSW 5 121314907 nonsense probably null
R4564:Hectd4 UTSW 5 121350431 missense probably benign 0.33
R4582:Hectd4 UTSW 5 121286419 missense possibly damaging 0.53
R4629:Hectd4 UTSW 5 121297203 missense probably benign 0.01
R4633:Hectd4 UTSW 5 121349216 missense probably benign 0.33
R4643:Hectd4 UTSW 5 121349055 missense possibly damaging 0.53
R4679:Hectd4 UTSW 5 121325251 missense possibly damaging 0.72
R4681:Hectd4 UTSW 5 121303615 missense possibly damaging 0.86
R4734:Hectd4 UTSW 5 121341977 missense possibly damaging 0.53
R4739:Hectd4 UTSW 5 121348442 missense probably benign
R4781:Hectd4 UTSW 5 121306107 critical splice donor site probably null
R4860:Hectd4 UTSW 5 121305818 missense probably benign 0.04
R4860:Hectd4 UTSW 5 121305818 missense probably benign 0.04
R4869:Hectd4 UTSW 5 121322672 missense possibly damaging 0.46
R4909:Hectd4 UTSW 5 121263891 missense probably benign 0.18
R4922:Hectd4 UTSW 5 121359315 missense possibly damaging 0.86
R4925:Hectd4 UTSW 5 121322690 missense possibly damaging 0.83
R5004:Hectd4 UTSW 5 121328199 splice site probably null
R5004:Hectd4 UTSW 5 121329565 missense possibly damaging 0.93
R5129:Hectd4 UTSW 5 121343510 missense possibly damaging 0.87
R5217:Hectd4 UTSW 5 121353551 missense possibly damaging 0.53
R5267:Hectd4 UTSW 5 121344824 missense probably benign 0.28
R5344:Hectd4 UTSW 5 121343676 missense probably benign 0.28
R5345:Hectd4 UTSW 5 121263974 missense possibly damaging 0.85
R5347:Hectd4 UTSW 5 121304448 missense probably benign 0.33
R5360:Hectd4 UTSW 5 121315401 missense possibly damaging 0.90
R5363:Hectd4 UTSW 5 121310603 missense probably benign 0.04
R5445:Hectd4 UTSW 5 121266274 missense probably benign 0.00
R5479:Hectd4 UTSW 5 121306948 missense probably benign
R5507:Hectd4 UTSW 5 121281101 missense unknown
R5552:Hectd4 UTSW 5 121342851 missense possibly damaging 0.96
R5691:Hectd4 UTSW 5 121348815 missense possibly damaging 0.85
R5745:Hectd4 UTSW 5 121353502 missense possibly damaging 0.96
R5757:Hectd4 UTSW 5 121348619 missense possibly damaging 0.72
R5845:Hectd4 UTSW 5 121307524 critical splice donor site probably null
R5869:Hectd4 UTSW 5 121343225 critical splice donor site probably null
R5913:Hectd4 UTSW 5 121323974 missense possibly damaging 0.83
R5920:Hectd4 UTSW 5 121308271 missense possibly damaging 0.65
R5943:Hectd4 UTSW 5 121322294 missense probably benign 0.01
R6219:Hectd4 UTSW 5 121308878 missense possibly damaging 0.92
R6250:Hectd4 UTSW 5 121339498 missense possibly damaging 0.85
R6301:Hectd4 UTSW 5 121254220 missense possibly damaging 0.91
R6428:Hectd4 UTSW 5 121350445 missense possibly damaging 0.53
R6446:Hectd4 UTSW 5 121334375 missense possibly damaging 0.86
R6453:Hectd4 UTSW 5 121350592 missense probably damaging 1.00
R6513:Hectd4 UTSW 5 121356196 splice site probably null
R6540:Hectd4 UTSW 5 121303571 missense probably benign 0.33
R6706:Hectd4 UTSW 5 121320084 missense possibly damaging 0.92
R6720:Hectd4 UTSW 5 121307381 nonsense probably null
R6736:Hectd4 UTSW 5 121277725 missense possibly damaging 0.86
R6776:Hectd4 UTSW 5 121353511 missense possibly damaging 0.85
R7033:Hectd4 UTSW 5 121364568 missense possibly damaging 0.86
R7038:Hectd4 UTSW 5 121299597 missense possibly damaging 0.90
R7175:Hectd4 UTSW 5 121273629 missense possibly damaging 0.85
R7180:Hectd4 UTSW 5 121308342 missense probably benign 0.01
R7234:Hectd4 UTSW 5 121329073 missense possibly damaging 0.53
R7253:Hectd4 UTSW 5 121314881 missense possibly damaging 0.66
R7349:Hectd4 UTSW 5 121310663 missense probably damaging 0.97
R7450:Hectd4 UTSW 5 121281932 missense probably benign 0.00
R7467:Hectd4 UTSW 5 121323961 missense possibly damaging 0.66
R7475:Hectd4 UTSW 5 121358133 splice site probably null
R7482:Hectd4 UTSW 5 121363878 missense possibly damaging 0.71
R7512:Hectd4 UTSW 5 121297109 missense possibly damaging 0.72
R7525:Hectd4 UTSW 5 121343665 missense possibly damaging 0.70
R7559:Hectd4 UTSW 5 121315510 splice site probably null
R7560:Hectd4 UTSW 5 121254342 missense possibly damaging 0.53
R7561:Hectd4 UTSW 5 121291225 missense possibly damaging 0.91
R7576:Hectd4 UTSW 5 121349459 missense possibly damaging 0.91
R7584:Hectd4 UTSW 5 121318735 missense possibly damaging 0.83
R7648:Hectd4 UTSW 5 121254371 missense possibly damaging 0.73
R7663:Hectd4 UTSW 5 121324031 missense probably benign 0.06
R7692:Hectd4 UTSW 5 121321564 missense possibly damaging 0.46
R7725:Hectd4 UTSW 5 121220617 missense unknown
R7731:Hectd4 UTSW 5 121307014 missense probably benign 0.00
R7732:Hectd4 UTSW 5 121336629 missense probably benign 0.14
R7782:Hectd4 UTSW 5 121305721 missense possibly damaging 0.53
R7854:Hectd4 UTSW 5 121329568 missense probably benign 0.27
R7898:Hectd4 UTSW 5 121331817 missense probably benign 0.18
R7910:Hectd4 UTSW 5 121254228 missense possibly damaging 0.86
R7962:Hectd4 UTSW 5 121310629 missense probably damaging 0.98
R8003:Hectd4 UTSW 5 121339518 missense possibly damaging 0.85
R8098:Hectd4 UTSW 5 121321398 missense possibly damaging 0.46
R8110:Hectd4 UTSW 5 121332949 missense possibly damaging 0.96
R8118:Hectd4 UTSW 5 121286376 missense probably benign 0.33
R8348:Hectd4 UTSW 5 121220256 start gained probably benign
R8397:Hectd4 UTSW 5 121259894 missense probably damaging 0.98
R8436:Hectd4 UTSW 5 121308358 missense possibly damaging 0.90
R8436:Hectd4 UTSW 5 121343147 missense probably benign 0.00
R8443:Hectd4 UTSW 5 121329109 missense possibly damaging 0.72
R8448:Hectd4 UTSW 5 121220256 start gained probably benign
R8516:Hectd4 UTSW 5 121349010 missense possibly damaging 0.53
R8519:Hectd4 UTSW 5 121304426 nonsense probably null
R8553:Hectd4 UTSW 5 121353598 missense possibly damaging 0.73
R8557:Hectd4 UTSW 5 121310651 missense possibly damaging 0.66
R8725:Hectd4 UTSW 5 121350494 missense probably damaging 1.00
R8751:Hectd4 UTSW 5 121363775 nonsense probably null
R8769:Hectd4 UTSW 5 121281873 missense possibly damaging 0.53
R8803:Hectd4 UTSW 5 121323931 missense probably benign 0.01
R8887:Hectd4 UTSW 5 121295478 missense probably benign 0.44
R8982:Hectd4 UTSW 5 121328242 missense probably benign 0.02
R8988:Hectd4 UTSW 5 121277756 missense possibly damaging 0.86
R8991:Hectd4 UTSW 5 121358284 missense probably benign 0.33
R8994:Hectd4 UTSW 5 121303566 missense probably benign 0.33
R8995:Hectd4 UTSW 5 121254359 missense possibly damaging 0.96
R9049:Hectd4 UTSW 5 121313892 missense possibly damaging 0.92
R9093:Hectd4 UTSW 5 121273614 missense probably benign 0.14
R9106:Hectd4 UTSW 5 121329556 missense possibly damaging 0.53
R9137:Hectd4 UTSW 5 121358175 missense possibly damaging 0.53
R9146:Hectd4 UTSW 5 121349034 missense probably benign 0.33
R9154:Hectd4 UTSW 5 121253904 missense
R9162:Hectd4 UTSW 5 121306979 missense possibly damaging 0.66
R9166:Hectd4 UTSW 5 121308627 missense probably damaging 0.96
R9183:Hectd4 UTSW 5 121299488 missense possibly damaging 0.51
R9207:Hectd4 UTSW 5 121295433 missense possibly damaging 0.86
R9291:Hectd4 UTSW 5 121348965 missense probably benign 0.14
R9300:Hectd4 UTSW 5 121348889 missense probably benign 0.33
R9314:Hectd4 UTSW 5 121299645 critical splice donor site probably null
R9381:Hectd4 UTSW 5 121334429 missense possibly damaging 0.53
R9432:Hectd4 UTSW 5 121322801 missense probably benign 0.01
R9491:Hectd4 UTSW 5 121314918 missense probably damaging 0.97
R9532:Hectd4 UTSW 5 121364553 missense probably benign 0.00
R9557:Hectd4 UTSW 5 121321554 missense not run
R9561:Hectd4 UTSW 5 121334469 missense not run
R9593:Hectd4 UTSW 5 121286781 nonsense probably null
X0026:Hectd4 UTSW 5 121349637 missense probably benign 0.04
X0027:Hectd4 UTSW 5 121321404 missense probably benign 0.27
Z1088:Hectd4 UTSW 5 121295503 splice site probably null
Z1177:Hectd4 UTSW 5 121358320 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tgtgctcttaacagttcattcatc -3'
Posted On 2014-01-05