Incidental Mutation 'R1129:Sbsn'
ID96479
Institutional Source Beutler Lab
Gene Symbol Sbsn
Ensembl Gene ENSMUSG00000046056
Gene Namesuprabasin
Synonyms1110005D19Rik
MMRRC Submission 039202-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1129 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location30751471-30756134 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30753440 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 627 (P627S)
Ref Sequence ENSEMBL: ENSMUSP00000079362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080518] [ENSMUST00000182227] [ENSMUST00000182229] [ENSMUST00000182721]
Predicted Effect probably benign
Transcript: ENSMUST00000080518
AA Change: P627S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079362
Gene: ENSMUSG00000046056
AA Change: P627S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
internal_repeat_2 27 208 2.58e-16 PROSPERO
internal_repeat_1 39 233 7e-25 PROSPERO
low complexity region 295 307 N/A INTRINSIC
low complexity region 313 325 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
low complexity region 349 361 N/A INTRINSIC
internal_repeat_2 380 568 2.58e-16 PROSPERO
internal_repeat_1 446 626 7e-25 PROSPERO
low complexity region 637 651 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182227
SMART Domains Protein: ENSMUSP00000138427
Gene: ENSMUSG00000046056

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 47 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182229
SMART Domains Protein: ENSMUSP00000138561
Gene: ENSMUSG00000046056

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 114 135 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182577
SMART Domains Protein: ENSMUSP00000138367
Gene: ENSMUSG00000046056

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182721
SMART Domains Protein: ENSMUSP00000138654
Gene: ENSMUSG00000046056

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
internal_repeat_1 26 68 1.41e-7 PROSPERO
internal_repeat_1 84 126 1.41e-7 PROSPERO
low complexity region 128 145 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrm1 G C 2: 180,172,919 probably benign Het
Bub1b A T 2: 118,615,006 D269V probably damaging Het
Ccdc73 A G 2: 104,992,190 N828S possibly damaging Het
Cdk12 T C 11: 98,245,375 S1152P unknown Het
Cnnm3 T C 1: 36,513,016 L369P probably damaging Het
Cxadr A G 16: 78,336,433 K360R probably benign Het
Dlg2 G A 7: 92,431,174 probably null Het
Dst T C 1: 34,199,554 V3779A probably benign Het
Fbxo16 G A 14: 65,295,532 R161K probably benign Het
Gm9726 T A 12: 93,928,526 noncoding transcript Het
Hectd4 A G 5: 121,310,599 T337A possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Ints1 A G 5: 139,758,471 L1510S probably benign Het
Kansl2 T C 15: 98,533,581 Y63C probably damaging Het
Lats2 T C 14: 57,700,333 E233G possibly damaging Het
Naca T C 10: 128,040,202 probably benign Het
Pprc1 G T 19: 46,063,806 A591S probably benign Het
Sema6b T C 17: 56,124,347 E772G probably benign Het
Tmem33 A G 5: 67,264,460 probably null Het
Tmtc4 A G 14: 122,943,153 probably null Het
Ubqlnl A T 7: 104,149,650 H213Q probably damaging Het
Ugt1a10 T C 1: 88,055,609 M43T probably benign Het
Vmn2r68 T C 7: 85,237,504 probably null Het
Zcchc14 A G 8: 121,608,415 probably benign Het
Other mutations in Sbsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01479:Sbsn APN 7 30752357 missense possibly damaging 0.90
IGL02649:Sbsn APN 7 30753258 missense probably damaging 0.96
IGL03154:Sbsn APN 7 30751728 missense possibly damaging 0.94
PIT4495001:Sbsn UTSW 7 30752966 intron probably benign
PIT4687001:Sbsn UTSW 7 30752966 intron probably benign
R0427:Sbsn UTSW 7 30752098 intron probably benign
R0892:Sbsn UTSW 7 30754819 missense possibly damaging 0.46
R1388:Sbsn UTSW 7 30752151 missense probably benign 0.09
R1437:Sbsn UTSW 7 30753053 nonsense probably null
R2436:Sbsn UTSW 7 30752230 missense possibly damaging 0.53
R4020:Sbsn UTSW 7 30755965 missense probably damaging 0.98
R5485:Sbsn UTSW 7 30753117 missense possibly damaging 0.46
R5890:Sbsn UTSW 7 30753267 missense possibly damaging 0.46
R6616:Sbsn UTSW 7 30753279 missense possibly damaging 0.92
R6969:Sbsn UTSW 7 30753191 missense probably benign
R7302:Sbsn UTSW 7 30751884 missense probably benign 0.34
R7455:Sbsn UTSW 7 30753177 missense possibly damaging 0.46
R8225:Sbsn UTSW 7 30751994 intron probably benign
R8225:Sbsn UTSW 7 30752444 missense probably benign 0.00
R8330:Sbsn UTSW 7 30751941 missense possibly damaging 0.83
R8403:Sbsn UTSW 7 30751994 intron probably benign
Z1088:Sbsn UTSW 7 30751751 nonsense probably null
Z1177:Sbsn UTSW 7 30752330 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ACTGGGTTCAACCAGGGTCAAAAG -3'
(R):5'- TGCAGACAAGATGGTCTAAACCAGC -3'

Sequencing Primer
(F):5'- CAACCAGGGTCAAAAGGAAGC -3'
(R):5'- GCTTCCCAAAGGTTTAGCCT -3'
Posted On2014-01-05