Incidental Mutation 'R1129:Cdk12'
List |< first << previous [record 4 of 25] next >> last >|
ID96497
Institutional Source Beutler Lab
Gene Symbol Cdk12
Ensembl Gene ENSMUSG00000003119
Gene Namecyclin-dependent kinase 12
SynonymsCrkrs, 1810022J16Rik, D11Ertd752e, Crk7
MMRRC Submission 039202-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1129 (G1)
Quality Score156
Status Not validated
Chromosome11
Chromosomal Location98203059-98278504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98245375 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1152 (S1152P)
Ref Sequence ENSEMBL: ENSMUSP00000103163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003203] [ENSMUST00000107538] [ENSMUST00000107539]
Predicted Effect unknown
Transcript: ENSMUST00000003203
AA Change: S1152P
SMART Domains Protein: ENSMUSP00000003203
Gene: ENSMUSG00000003119
AA Change: S1152P

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 103 123 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 286 384 N/A INTRINSIC
low complexity region 511 568 N/A INTRINSIC
low complexity region 623 633 N/A INTRINSIC
low complexity region 666 684 N/A INTRINSIC
S_TKc 723 1016 1.49e-95 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107538
AA Change: S1152P
SMART Domains Protein: ENSMUSP00000103162
Gene: ENSMUSG00000003119
AA Change: S1152P

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 103 123 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 286 384 N/A INTRINSIC
low complexity region 511 568 N/A INTRINSIC
low complexity region 623 633 N/A INTRINSIC
low complexity region 666 684 N/A INTRINSIC
S_TKc 723 1016 1.49e-95 SMART
low complexity region 1252 1276 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000107539
AA Change: S1152P
SMART Domains Protein: ENSMUSP00000103163
Gene: ENSMUSG00000003119
AA Change: S1152P

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 103 123 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 286 384 N/A INTRINSIC
low complexity region 511 568 N/A INTRINSIC
low complexity region 623 633 N/A INTRINSIC
low complexity region 666 684 N/A INTRINSIC
S_TKc 723 1016 1.49e-95 SMART
low complexity region 1253 1267 N/A INTRINSIC
low complexity region 1458 1474 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147441
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality between implantation and E6.5 with decreased proliferation and increased apoptosis in the inner cell mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrm1 G C 2: 180,172,919 probably benign Het
Bub1b A T 2: 118,615,006 D269V probably damaging Het
Ccdc73 A G 2: 104,992,190 N828S possibly damaging Het
Cnnm3 T C 1: 36,513,016 L369P probably damaging Het
Cxadr A G 16: 78,336,433 K360R probably benign Het
Dlg2 G A 7: 92,431,174 probably null Het
Dst T C 1: 34,199,554 V3779A probably benign Het
Fbxo16 G A 14: 65,295,532 R161K probably benign Het
Gm9726 T A 12: 93,928,526 noncoding transcript Het
Hectd4 A G 5: 121,310,599 T337A possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Ints1 A G 5: 139,758,471 L1510S probably benign Het
Kansl2 T C 15: 98,533,581 Y63C probably damaging Het
Lats2 T C 14: 57,700,333 E233G possibly damaging Het
Naca T C 10: 128,040,202 probably benign Het
Pprc1 G T 19: 46,063,806 A591S probably benign Het
Sbsn C T 7: 30,753,440 P627S probably benign Het
Sema6b T C 17: 56,124,347 E772G probably benign Het
Tmem33 A G 5: 67,264,460 probably null Het
Tmtc4 A G 14: 122,943,153 probably null Het
Ubqlnl A T 7: 104,149,650 H213Q probably damaging Het
Ugt1a10 T C 1: 88,055,609 M43T probably benign Het
Vmn2r68 T C 7: 85,237,504 probably null Het
Zcchc14 A G 8: 121,608,415 probably benign Het
Other mutations in Cdk12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Cdk12 APN 11 98245388 missense unknown
IGL00718:Cdk12 APN 11 98249676 intron probably benign
IGL00850:Cdk12 APN 11 98222665 missense unknown
IGL01299:Cdk12 APN 11 98210446 missense unknown
IGL01443:Cdk12 APN 11 98245469 missense unknown
IGL01597:Cdk12 APN 11 98250264 unclassified probably benign
capsized UTSW 11 98241785 missense unknown
Listing UTSW 11 98224467 nonsense probably null
Torpedoed UTSW 11 98221102 missense unknown
R0124:Cdk12 UTSW 11 98211247 splice site probably benign
R0157:Cdk12 UTSW 11 98249776 unclassified probably benign
R0190:Cdk12 UTSW 11 98241831 critical splice donor site probably null
R0230:Cdk12 UTSW 11 98203991 missense probably damaging 1.00
R0467:Cdk12 UTSW 11 98203579 missense probably damaging 0.99
R0577:Cdk12 UTSW 11 98203506 missense probably damaging 0.99
R0671:Cdk12 UTSW 11 98230109 splice site probably benign
R0834:Cdk12 UTSW 11 98204385 missense probably benign 0.23
R1337:Cdk12 UTSW 11 98245671 critical splice donor site probably null
R1344:Cdk12 UTSW 11 98241785 missense unknown
R1418:Cdk12 UTSW 11 98241785 missense unknown
R1729:Cdk12 UTSW 11 98249970 unclassified probably benign
R1756:Cdk12 UTSW 11 98241761 nonsense probably null
R1784:Cdk12 UTSW 11 98249970 unclassified probably benign
R1807:Cdk12 UTSW 11 98210377 missense unknown
R1956:Cdk12 UTSW 11 98219216 missense probably benign 0.23
R1966:Cdk12 UTSW 11 98204090 nonsense probably null
R2202:Cdk12 UTSW 11 98210638 missense unknown
R2422:Cdk12 UTSW 11 98219074 missense probably benign 0.23
R2570:Cdk12 UTSW 11 98203792 missense possibly damaging 0.94
R4574:Cdk12 UTSW 11 98220988 intron probably benign
R4614:Cdk12 UTSW 11 98249777 unclassified probably benign
R4882:Cdk12 UTSW 11 98210446 missense unknown
R4921:Cdk12 UTSW 11 98222687 missense unknown
R5151:Cdk12 UTSW 11 98249923 unclassified probably benign
R5252:Cdk12 UTSW 11 98243509 missense unknown
R5348:Cdk12 UTSW 11 98204292 missense probably benign 0.23
R5620:Cdk12 UTSW 11 98210983 missense unknown
R5779:Cdk12 UTSW 11 98219074 missense probably benign 0.23
R6085:Cdk12 UTSW 11 98243429 missense unknown
R6293:Cdk12 UTSW 11 98224553 missense unknown
R6371:Cdk12 UTSW 11 98245288 missense unknown
R6438:Cdk12 UTSW 11 98224467 nonsense probably null
R6765:Cdk12 UTSW 11 98224529 missense unknown
R6958:Cdk12 UTSW 11 98241699 missense unknown
R7205:Cdk12 UTSW 11 98224625 missense unknown
R7307:Cdk12 UTSW 11 98249800 nonsense probably null
R7361:Cdk12 UTSW 11 98210468 nonsense probably null
R7365:Cdk12 UTSW 11 98221084 missense unknown
R7447:Cdk12 UTSW 11 98245280 missense unknown
R7514:Cdk12 UTSW 11 98222658 missense unknown
R7831:Cdk12 UTSW 11 98249827 missense unknown
R7877:Cdk12 UTSW 11 98240835 missense unknown
R7975:Cdk12 UTSW 11 98221102 missense unknown
R8507:Cdk12 UTSW 11 98250285 missense unknown
Z1176:Cdk12 UTSW 11 98203941 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTGACATCACACAGCAGTTGAATC -3'
(R):5'- TTTAAGAGGATCAACAGCACCTGAGC -3'

Sequencing Primer
(F):5'- TCACACAGCAGTTGAATCAAAGTG -3'
(R):5'- GCTCAATGAGATTCATGACCG -3'
Posted On2014-01-05