Incidental Mutation 'R1129:Gm9726'
ID96499
Institutional Source Beutler Lab
Gene Symbol Gm9726
Ensembl Gene ENSMUSG00000094935
Gene Namepredicted gene 9726
Synonyms
MMRRC Submission 039202-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R1129 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location93927004-93929102 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 93928526 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180321
SMART Domains Protein: ENSMUSP00000136020
Gene: ENSMUSG00000094935

DomainStartEndE-ValueType
low complexity region 10 19 N/A INTRINSIC
LysM 41 85 2.58e-7 SMART
low complexity region 100 108 N/A INTRINSIC
low complexity region 117 132 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183568
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrm1 G C 2: 180,172,919 probably benign Het
Bub1b A T 2: 118,615,006 D269V probably damaging Het
Ccdc73 A G 2: 104,992,190 N828S possibly damaging Het
Cdk12 T C 11: 98,245,375 S1152P unknown Het
Cnnm3 T C 1: 36,513,016 L369P probably damaging Het
Cxadr A G 16: 78,336,433 K360R probably benign Het
Dlg2 G A 7: 92,431,174 probably null Het
Dst T C 1: 34,199,554 V3779A probably benign Het
Fbxo16 G A 14: 65,295,532 R161K probably benign Het
Hectd4 A G 5: 121,310,599 T337A possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Ints1 A G 5: 139,758,471 L1510S probably benign Het
Kansl2 T C 15: 98,533,581 Y63C probably damaging Het
Lats2 T C 14: 57,700,333 E233G possibly damaging Het
Naca T C 10: 128,040,202 probably benign Het
Pprc1 G T 19: 46,063,806 A591S probably benign Het
Sbsn C T 7: 30,753,440 P627S probably benign Het
Sema6b T C 17: 56,124,347 E772G probably benign Het
Tmem33 A G 5: 67,264,460 probably null Het
Tmtc4 A G 14: 122,943,153 probably null Het
Ubqlnl A T 7: 104,149,650 H213Q probably damaging Het
Ugt1a10 T C 1: 88,055,609 M43T probably benign Het
Vmn2r68 T C 7: 85,237,504 probably null Het
Zcchc14 A G 8: 121,608,415 probably benign Het
Other mutations in Gm9726
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0841:Gm9726 UTSW 12 93928280 unclassified noncoding transcript
R1145:Gm9726 UTSW 12 93928280 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTCTGGGCAGCAGCCTTCTTTGAC -3'
(R):5'- AATGTAACCGGCCTGGCAGACTTC -3'

Sequencing Primer
(F):5'- GAAGATGATCCGATCTCATCCTTAC -3'
(R):5'- ACGACGAATGTAGTCTCTCG -3'
Posted On2014-01-05