Incidental Mutation 'R1129:Lats2'
ID96507
Institutional Source Beutler Lab
Gene Symbol Lats2
Ensembl Gene ENSMUSG00000021959
Gene Namelarge tumor suppressor 2
Synonyms
MMRRC Submission 039202-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1129 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location57689662-57758388 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57700333 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 233 (E233G)
Ref Sequence ENSEMBL: ENSMUSP00000133976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022531] [ENSMUST00000173964] [ENSMUST00000173990] [ENSMUST00000174166] [ENSMUST00000174213] [ENSMUST00000174694]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022531
AA Change: E233G

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022531
Gene: ENSMUSG00000021959
AA Change: E233G

DomainStartEndE-ValueType
PDB:2COS|A 91 138 3e-20 PDB
low complexity region 210 223 N/A INTRINSIC
low complexity region 401 408 N/A INTRINSIC
low complexity region 437 444 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
S_TKc 626 931 2.94e-94 SMART
S_TK_X 932 1002 1.21e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172474
Predicted Effect probably benign
Transcript: ENSMUST00000173964
SMART Domains Protein: ENSMUSP00000134142
Gene: ENSMUSG00000021959

DomainStartEndE-ValueType
low complexity region 21 28 N/A INTRINSIC
low complexity region 57 64 N/A INTRINSIC
low complexity region 91 102 N/A INTRINSIC
low complexity region 137 149 N/A INTRINSIC
Pfam:Pkinase 233 288 2.3e-5 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173990
AA Change: E233G

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133976
Gene: ENSMUSG00000021959
AA Change: E233G

DomainStartEndE-ValueType
PDB:2COS|A 91 138 8e-22 PDB
low complexity region 210 223 N/A INTRINSIC
low complexity region 401 408 N/A INTRINSIC
low complexity region 437 444 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
S_TKc 626 893 7.75e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174166
SMART Domains Protein: ENSMUSP00000133379
Gene: ENSMUSG00000021959

DomainStartEndE-ValueType
PDB:2COS|A 91 114 5e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000174213
SMART Domains Protein: ENSMUSP00000134321
Gene: ENSMUSG00000021959

DomainStartEndE-ValueType
PDB:2COS|A 91 114 2e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000174694
AA Change: E233G

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133680
Gene: ENSMUSG00000114942
AA Change: E233G

DomainStartEndE-ValueType
PDB:2COS|A 91 138 7e-22 PDB
low complexity region 210 223 N/A INTRINSIC
low complexity region 401 408 N/A INTRINSIC
low complexity region 437 444 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
Pfam:Pkinase 626 792 2.2e-38 PFAM
Pfam:Pkinase_Tyr 626 795 2.8e-21 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase belonging to the LATS tumor suppressor family. The protein localizes to centrosomes during interphase, and early and late metaphase. It interacts with the centrosomal proteins aurora-A and ajuba and is required for accumulation of gamma-tubulin and spindle formation at the onset of mitosis. It also interacts with a negative regulator of p53 and may function in a positive feedback loop with p53 that responds to cytoskeleton damage. Additionally, it can function as a co-repressor of androgen-responsive gene expression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality with decreased cell proliferation, chromosomal instability, atrial hyperplasia, ventricular hypoplasia, delayed embryonic development, an irregular kinked neural tube, and hemorrhages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrm1 G C 2: 180,172,919 probably benign Het
Bub1b A T 2: 118,615,006 D269V probably damaging Het
Ccdc73 A G 2: 104,992,190 N828S possibly damaging Het
Cdk12 T C 11: 98,245,375 S1152P unknown Het
Cnnm3 T C 1: 36,513,016 L369P probably damaging Het
Cxadr A G 16: 78,336,433 K360R probably benign Het
Dlg2 G A 7: 92,431,174 probably null Het
Dst T C 1: 34,199,554 V3779A probably benign Het
Fbxo16 G A 14: 65,295,532 R161K probably benign Het
Gm9726 T A 12: 93,928,526 noncoding transcript Het
Hectd4 A G 5: 121,310,599 T337A possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Ints1 A G 5: 139,758,471 L1510S probably benign Het
Kansl2 T C 15: 98,533,581 Y63C probably damaging Het
Naca T C 10: 128,040,202 probably benign Het
Pprc1 G T 19: 46,063,806 A591S probably benign Het
Sbsn C T 7: 30,753,440 P627S probably benign Het
Sema6b T C 17: 56,124,347 E772G probably benign Het
Tmem33 A G 5: 67,264,460 probably null Het
Tmtc4 A G 14: 122,943,153 probably null Het
Ubqlnl A T 7: 104,149,650 H213Q probably damaging Het
Ugt1a10 T C 1: 88,055,609 M43T probably benign Het
Vmn2r68 T C 7: 85,237,504 probably null Het
Zcchc14 A G 8: 121,608,415 probably benign Het
Other mutations in Lats2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Lats2 APN 14 57691569 missense probably benign 0.09
IGL02104:Lats2 APN 14 57734012 missense probably damaging 1.00
IGL02173:Lats2 APN 14 57697260 missense probably damaging 1.00
IGL02377:Lats2 APN 14 57691595 missense probably damaging 1.00
IGL02995:Lats2 APN 14 57700348 missense probably damaging 1.00
R6846_Lats2_781 UTSW 14 57696134 missense probably damaging 1.00
PIT4472001:Lats2 UTSW 14 57699357 nonsense probably null
R0653:Lats2 UTSW 14 57700196 nonsense probably null
R0780:Lats2 UTSW 14 57691296 missense probably damaging 1.00
R1851:Lats2 UTSW 14 57697455 missense probably damaging 1.00
R1882:Lats2 UTSW 14 57697354 missense probably damaging 1.00
R2184:Lats2 UTSW 14 57691559 missense probably damaging 0.99
R3498:Lats2 UTSW 14 57722466 missense possibly damaging 0.95
R3692:Lats2 UTSW 14 57691541 missense probably damaging 1.00
R4212:Lats2 UTSW 14 57696255 missense possibly damaging 0.82
R4357:Lats2 UTSW 14 57699383 missense probably damaging 1.00
R4962:Lats2 UTSW 14 57699592 missense probably damaging 1.00
R5394:Lats2 UTSW 14 57691353 missense probably benign 0.10
R5477:Lats2 UTSW 14 57699553 missense probably benign 0.00
R5729:Lats2 UTSW 14 57722735 missense probably benign 0.04
R5802:Lats2 UTSW 14 57694418 missense probably damaging 0.99
R5931:Lats2 UTSW 14 57696131 missense probably damaging 1.00
R6016:Lats2 UTSW 14 57734175 missense probably damaging 1.00
R6376:Lats2 UTSW 14 57722509 missense probably benign 0.00
R6624:Lats2 UTSW 14 57694312 critical splice donor site probably null
R6638:Lats2 UTSW 14 57699365 missense probably damaging 1.00
R6846:Lats2 UTSW 14 57696134 missense probably damaging 1.00
R7198:Lats2 UTSW 14 57697125 missense probably damaging 1.00
R7233:Lats2 UTSW 14 57722694 splice site probably null
R7883:Lats2 UTSW 14 57697200 missense probably damaging 1.00
R8081:Lats2 UTSW 14 57700511 missense probably damaging 1.00
R8508:Lats2 UTSW 14 57722705 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTTCGCCAGTAAACGTGGGACC -3'
(R):5'- GCTACTCTGGGAATCAACCTGCAAG -3'

Sequencing Primer
(F):5'- GGTGCCCAACACATGTAATG -3'
(R):5'- ACCATGTGCTCTGAGGCTG -3'
Posted On2014-01-05