Incidental Mutation 'R1129:Fbxo16'
List |< first << previous [record 9 of 25] next >> last >|
ID96509
Institutional Source Beutler Lab
Gene Symbol Fbxo16
Ensembl Gene ENSMUSG00000034532
Gene NameF-box protein 16
SynonymsFbx16
MMRRC Submission 039202-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R1129 (G1)
Quality Score102
Status Not validated
Chromosome14
Chromosomal Location65266618-65323973 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 65295532 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 161 (R161K)
Ref Sequence ENSEMBL: ENSMUSP00000153094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169656] [ENSMUST00000224629] [ENSMUST00000226005]
Predicted Effect probably benign
Transcript: ENSMUST00000169656
AA Change: R161K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130805
Gene: ENSMUSG00000034532
AA Change: R161K

DomainStartEndE-ValueType
FBOX 92 132 3.43e-3 SMART
low complexity region 194 206 N/A INTRINSIC
low complexity region 323 334 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223608
Predicted Effect probably benign
Transcript: ENSMUST00000224629
AA Change: R161K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000226005
AA Change: R161K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrm1 G C 2: 180,172,919 probably benign Het
Bub1b A T 2: 118,615,006 D269V probably damaging Het
Ccdc73 A G 2: 104,992,190 N828S possibly damaging Het
Cdk12 T C 11: 98,245,375 S1152P unknown Het
Cnnm3 T C 1: 36,513,016 L369P probably damaging Het
Cxadr A G 16: 78,336,433 K360R probably benign Het
Dlg2 G A 7: 92,431,174 probably null Het
Dst T C 1: 34,199,554 V3779A probably benign Het
Gm9726 T A 12: 93,928,526 noncoding transcript Het
Hectd4 A G 5: 121,310,599 T337A possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Ints1 A G 5: 139,758,471 L1510S probably benign Het
Kansl2 T C 15: 98,533,581 Y63C probably damaging Het
Lats2 T C 14: 57,700,333 E233G possibly damaging Het
Naca T C 10: 128,040,202 probably benign Het
Pprc1 G T 19: 46,063,806 A591S probably benign Het
Sbsn C T 7: 30,753,440 P627S probably benign Het
Sema6b T C 17: 56,124,347 E772G probably benign Het
Tmem33 A G 5: 67,264,460 probably null Het
Tmtc4 A G 14: 122,943,153 probably null Het
Ubqlnl A T 7: 104,149,650 H213Q probably damaging Het
Ugt1a10 T C 1: 88,055,609 M43T probably benign Het
Vmn2r68 T C 7: 85,237,504 probably null Het
Zcchc14 A G 8: 121,608,415 probably benign Het
Other mutations in Fbxo16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02491:Fbxo16 APN 14 65321287 missense probably benign 0.15
R1423:Fbxo16 UTSW 14 65287174 splice site probably benign
R1776:Fbxo16 UTSW 14 65295386 splice site probably null
R1862:Fbxo16 UTSW 14 65270803 missense probably damaging 1.00
R2504:Fbxo16 UTSW 14 65270714 start gained probably benign
R3431:Fbxo16 UTSW 14 65293784 missense probably damaging 0.97
R3432:Fbxo16 UTSW 14 65293784 missense probably damaging 0.97
R3976:Fbxo16 UTSW 14 65287157 missense probably damaging 1.00
R4065:Fbxo16 UTSW 14 65270829 missense probably damaging 1.00
R4922:Fbxo16 UTSW 14 65299208 missense probably benign
R4973:Fbxo16 UTSW 14 65321297 missense probably benign 0.00
R6637:Fbxo16 UTSW 14 65295761 splice site probably null
R7213:Fbxo16 UTSW 14 65299419 splice site probably null
R7274:Fbxo16 UTSW 14 65321267 missense probably benign 0.30
Z1088:Fbxo16 UTSW 14 65293860 missense possibly damaging 0.92
Z1177:Fbxo16 UTSW 14 65299358 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAGCTGAGCCTTCAAGGAAGATGAC -3'
(R):5'- GTCTGTGAAGCCTCTGAAGAGAAGC -3'

Sequencing Primer
(F):5'- GATGACAGACATTATCTGGGCTCC -3'
(R):5'- CTTGAAATCACGGGGTACGTC -3'
Posted On2014-01-05