Incidental Mutation 'R1129:Kansl2'
ID96515
Institutional Source Beutler Lab
Gene Symbol Kansl2
Ensembl Gene ENSMUSG00000022992
Gene NameKAT8 regulatory NSL complex subunit 2
Synonyms2310037I24Rik
MMRRC Submission 039202-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R1129 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98517658-98534264 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98533581 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 63 (Y63C)
Ref Sequence ENSEMBL: ENSMUSP00000155461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023727] [ENSMUST00000116400] [ENSMUST00000230542] [ENSMUST00000231066]
Predicted Effect probably damaging
Transcript: ENSMUST00000023727
AA Change: Y63C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023727
Gene: ENSMUSG00000022992
AA Change: Y63C

DomainStartEndE-ValueType
Pfam:zf-C3Hc3H 27 93 4.8e-19 PFAM
Pfam:zf-C3Hc3H 300 365 4.6e-19 PFAM
low complexity region 408 420 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000116400
AA Change: Y63C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112101
Gene: ENSMUSG00000022992
AA Change: Y63C

DomainStartEndE-ValueType
Pfam:zf-C3Hc3H 28 92 1e-19 PFAM
Pfam:zf-C3Hc3H 302 364 1.7e-16 PFAM
low complexity region 442 454 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229818
Predicted Effect probably damaging
Transcript: ENSMUST00000230542
AA Change: Y63C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231066
AA Change: Y63C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrm1 G C 2: 180,172,919 probably benign Het
Bub1b A T 2: 118,615,006 D269V probably damaging Het
Ccdc73 A G 2: 104,992,190 N828S possibly damaging Het
Cdk12 T C 11: 98,245,375 S1152P unknown Het
Cnnm3 T C 1: 36,513,016 L369P probably damaging Het
Cxadr A G 16: 78,336,433 K360R probably benign Het
Dlg2 G A 7: 92,431,174 probably null Het
Dst T C 1: 34,199,554 V3779A probably benign Het
Fbxo16 G A 14: 65,295,532 R161K probably benign Het
Gm9726 T A 12: 93,928,526 noncoding transcript Het
Hectd4 A G 5: 121,310,599 T337A possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Ints1 A G 5: 139,758,471 L1510S probably benign Het
Lats2 T C 14: 57,700,333 E233G possibly damaging Het
Naca T C 10: 128,040,202 probably benign Het
Pprc1 G T 19: 46,063,806 A591S probably benign Het
Sbsn C T 7: 30,753,440 P627S probably benign Het
Sema6b T C 17: 56,124,347 E772G probably benign Het
Tmem33 A G 5: 67,264,460 probably null Het
Tmtc4 A G 14: 122,943,153 probably null Het
Ubqlnl A T 7: 104,149,650 H213Q probably damaging Het
Ugt1a10 T C 1: 88,055,609 M43T probably benign Het
Vmn2r68 T C 7: 85,237,504 probably null Het
Zcchc14 A G 8: 121,608,415 probably benign Het
Other mutations in Kansl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Kansl2 APN 15 98528853 splice site probably benign
IGL02167:Kansl2 APN 15 98533515 splice site probably benign
IGL02349:Kansl2 APN 15 98529446 missense probably damaging 1.00
R0004:Kansl2 UTSW 15 98520376 missense probably damaging 1.00
R1128:Kansl2 UTSW 15 98533685 nonsense probably null
R1311:Kansl2 UTSW 15 98528916 missense possibly damaging 0.93
R2132:Kansl2 UTSW 15 98529397 missense probably damaging 1.00
R2144:Kansl2 UTSW 15 98526631 missense probably benign 0.00
R2232:Kansl2 UTSW 15 98524478 missense probably damaging 1.00
R2510:Kansl2 UTSW 15 98528861 critical splice donor site probably null
R3433:Kansl2 UTSW 15 98528861 critical splice donor site probably null
R4125:Kansl2 UTSW 15 98531755 missense possibly damaging 0.79
R4818:Kansl2 UTSW 15 98526661 missense possibly damaging 0.48
R4906:Kansl2 UTSW 15 98531890 missense possibly damaging 0.83
R4962:Kansl2 UTSW 15 98531843 missense probably benign 0.01
R5973:Kansl2 UTSW 15 98529425 missense probably damaging 1.00
R6014:Kansl2 UTSW 15 98520316 critical splice donor site probably null
R6077:Kansl2 UTSW 15 98531431 missense probably benign 0.08
R6657:Kansl2 UTSW 15 98524670 missense possibly damaging 0.67
R7168:Kansl2 UTSW 15 98529544 splice site probably null
R7418:Kansl2 UTSW 15 98531894 missense possibly damaging 0.95
R7530:Kansl2 UTSW 15 98529015 missense probably benign 0.01
R7957:Kansl2 UTSW 15 98524618 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACTCCAGCAAATTGGCCTCTGAC -3'
(R):5'- CCGCAGGTTTTGGCATGAACAG -3'

Sequencing Primer
(F):5'- gcctctgacctccccac -3'
(R):5'- TTGGCATGAACAGGATTCGG -3'
Posted On2014-01-05