Incidental Mutation 'R1129:Cxadr'
ID96517
Institutional Source Beutler Lab
Gene Symbol Cxadr
Ensembl Gene ENSMUSG00000022865
Gene Namecoxsackie virus and adenovirus receptor
SynonymsMCAR, MCVADR, 2610206D03Rik, CAR
MMRRC Submission 039202-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1129 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location78301489-78359774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78336433 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 360 (K360R)
Ref Sequence ENSEMBL: ENSMUSP00000023572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023572] [ENSMUST00000114229] [ENSMUST00000231353]
PDB Structure
Crystal structure of the extracellular domains of coxsackie & adenovirus receptor from mouse (mCAR) [X-RAY DIFFRACTION]
Crystal structure of the complex of JAML and Coxsackie and Adenovirus receptor, CAR [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000023572
AA Change: K360R

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023572
Gene: ENSMUSG00000022865
AA Change: K360R

DomainStartEndE-ValueType
IG 26 138 1.99e-7 SMART
IGc2 153 219 7.7e-5 SMART
low complexity region 262 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114229
SMART Domains Protein: ENSMUSP00000109867
Gene: ENSMUSG00000022865

DomainStartEndE-ValueType
IG 26 138 1.99e-7 SMART
IGc2 153 219 7.7e-5 SMART
low complexity region 262 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231251
Predicted Effect probably benign
Transcript: ENSMUST00000231353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232286
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is part of the Cortical Thymocyte marker in Xenopus (CTX) subfamily within the immunoglobulin superfamily. Members of this subfamily, predominantly expressed on the surface of endothelial and epithelial cells, help establish cell polarity and provide a barrier function, regulating migration of immune cells. This protein, first identified as the receptor for adenovirus subgroup C and coxsakieviruses group B, is developmentally regulated and plays an important role in cardiac development. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with focal cardiomyocyte apoptosis and extensive thoracic hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrm1 G C 2: 180,172,919 probably benign Het
Bub1b A T 2: 118,615,006 D269V probably damaging Het
Ccdc73 A G 2: 104,992,190 N828S possibly damaging Het
Cdk12 T C 11: 98,245,375 S1152P unknown Het
Cnnm3 T C 1: 36,513,016 L369P probably damaging Het
Dlg2 G A 7: 92,431,174 probably null Het
Dst T C 1: 34,199,554 V3779A probably benign Het
Fbxo16 G A 14: 65,295,532 R161K probably benign Het
Gm9726 T A 12: 93,928,526 noncoding transcript Het
Hectd4 A G 5: 121,310,599 T337A possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Ints1 A G 5: 139,758,471 L1510S probably benign Het
Kansl2 T C 15: 98,533,581 Y63C probably damaging Het
Lats2 T C 14: 57,700,333 E233G possibly damaging Het
Naca T C 10: 128,040,202 probably benign Het
Pprc1 G T 19: 46,063,806 A591S probably benign Het
Sbsn C T 7: 30,753,440 P627S probably benign Het
Sema6b T C 17: 56,124,347 E772G probably benign Het
Tmem33 A G 5: 67,264,460 probably null Het
Tmtc4 A G 14: 122,943,153 probably null Het
Ubqlnl A T 7: 104,149,650 H213Q probably damaging Het
Ugt1a10 T C 1: 88,055,609 M43T probably benign Het
Vmn2r68 T C 7: 85,237,504 probably null Het
Zcchc14 A G 8: 121,608,415 probably benign Het
Other mutations in Cxadr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Cxadr APN 16 78334227 nonsense probably null
R0309:Cxadr UTSW 16 78334948 missense probably benign 0.00
R1142:Cxadr UTSW 16 78334839 missense probably benign 0.04
R1713:Cxadr UTSW 16 78334245 missense probably damaging 1.00
R6432:Cxadr UTSW 16 78325259 missense probably damaging 1.00
R6637:Cxadr UTSW 16 78333503 missense possibly damaging 0.47
R7597:Cxadr UTSW 16 78329108 missense probably damaging 1.00
R7735:Cxadr UTSW 16 78329061 missense possibly damaging 0.92
R7809:Cxadr UTSW 16 78333519 critical splice donor site probably null
R7952:Cxadr UTSW 16 78334235 missense possibly damaging 0.89
R8073:Cxadr UTSW 16 78333413 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCAAAGAGTCGGACATCCACTGC -3'
(R):5'- CCCCAAATTTTCCAGATGGTCAATGC -3'

Sequencing Primer
(F):5'- ATCCACTGCCAGGAGCTATATTG -3'
(R):5'- TCCAGATGGTCAATGCTATTACTC -3'
Posted On2014-01-05