Mutagenetix > Incidental Mutations

Incidental Mutation 'R1018:Tpr'

96531

Institutional Source

Beutler Lab

Gene Symbol

Tpr

Ensembl Gene

ENSMUSG00000006005

Gene Name

translocated promoter region, nuclear basket protein

Synonyms

2610029M07Rik

MMRRC Submission

039122-MU

Accession Numbers

Genbank: NM_133780; MGI: 1922066

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1018 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

150392838-150449935 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 150442183 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 2147 (H2147Q)

Ref Sequence

ENSEMBL: ENSMUSP00000117616 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119161] [ENSMUST00000124484] [ENSMUST00000124973]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000119161
AA Change: H2073Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005
AA Change: H2073Q

Domain	Start	End	E-Value	Type
coiled coil region	49	370	N/A	INTRINSIC
coiled coil region	423	515	N/A	INTRINSIC
low complexity region	518	534	N/A	INTRINSIC
coiled coil region	539	604	N/A	INTRINSIC
low complexity region	690	703	N/A	INTRINSIC
low complexity region	782	795	N/A	INTRINSIC
low complexity region	811	826	N/A	INTRINSIC
low complexity region	1003	1019	N/A	INTRINSIC
Pfam:TPR_MLP1_2	1036	1167	9.1e-33	PFAM
coiled coil region	1215	1421	N/A	INTRINSIC
coiled coil region	1473	1629	N/A	INTRINSIC
internal_repeat_3	1630	1691	1.48e-5	PROSPERO
low complexity region	1695	1717	N/A	INTRINSIC
low complexity region	1761	1777	N/A	INTRINSIC
internal_repeat_5	1814	1827	5.58e-5	PROSPERO
internal_repeat_3	1819	1881	1.48e-5	PROSPERO
internal_repeat_4	1875	1895	5.58e-5	PROSPERO
internal_repeat_1	1893	1919	2.03e-6	PROSPERO
low complexity region	1920	1933	N/A	INTRINSIC
low complexity region	1942	1981	N/A	INTRINSIC
low complexity region	1989	2014	N/A	INTRINSIC
internal_repeat_4	2017	2036	5.58e-5	PROSPERO
low complexity region	2059	2078	N/A	INTRINSIC
internal_repeat_2	2084	2135	3.95e-6	PROSPERO
internal_repeat_5	2127	2140	5.58e-5	PROSPERO
internal_repeat_1	2154	2179	2.03e-6	PROSPERO
internal_repeat_2	2156	2212	3.95e-6	PROSPERO
low complexity region	2239	2251	N/A	INTRINSIC
low complexity region	2263	2277	N/A	INTRINSIC
low complexity region	2292	2314	N/A	INTRINSIC
low complexity region	2346	2357	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124484

SMART Domains

Protein: ENSMUSP00000121991
Gene: ENSMUSG00000006005

Domain	Start	End	E-Value	Type
low complexity region	26	38	N/A	INTRINSIC
low complexity region	50	64	N/A	INTRINSIC
low complexity region	79	101	N/A	INTRINSIC
low complexity region	133	144	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124973
AA Change: H2147Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005
AA Change: H2147Q

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
low complexity region	24	77	N/A	INTRINSIC
coiled coil region	123	444	N/A	INTRINSIC
coiled coil region	497	589	N/A	INTRINSIC
low complexity region	592	608	N/A	INTRINSIC
coiled coil region	613	678	N/A	INTRINSIC
low complexity region	764	777	N/A	INTRINSIC
low complexity region	856	869	N/A	INTRINSIC
low complexity region	885	900	N/A	INTRINSIC
low complexity region	1077	1093	N/A	INTRINSIC
Pfam:TPR_MLP1_2	1112	1240	5.1e-37	PFAM
coiled coil region	1289	1495	N/A	INTRINSIC
low complexity region	1682	1698	N/A	INTRINSIC
internal_repeat_5	1703	1750	8.04e-5	PROSPERO
internal_repeat_3	1704	1765	1.07e-5	PROSPERO
low complexity region	1769	1791	N/A	INTRINSIC
low complexity region	1835	1851	N/A	INTRINSIC
internal_repeat_5	1857	1900	8.04e-5	PROSPERO
internal_repeat_6	1887	1911	8.04e-5	PROSPERO
internal_repeat_3	1893	1955	1.07e-5	PROSPERO
internal_repeat_4	1949	1969	4.1e-5	PROSPERO
internal_repeat_1	1967	1993	1.42e-6	PROSPERO
low complexity region	1994	2007	N/A	INTRINSIC
low complexity region	2016	2055	N/A	INTRINSIC
low complexity region	2063	2088	N/A	INTRINSIC
internal_repeat_4	2091	2110	4.1e-5	PROSPERO
internal_repeat_6	2108	2132	8.04e-5	PROSPERO
low complexity region	2133	2152	N/A	INTRINSIC
internal_repeat_2	2158	2209	2.78e-6	PROSPERO
internal_repeat_1	2228	2253	1.42e-6	PROSPERO
internal_repeat_2	2230	2286	2.78e-6	PROSPERO
low complexity region	2313	2325	N/A	INTRINSIC
low complexity region	2337	2351	N/A	INTRINSIC
low complexity region	2366	2388	N/A	INTRINSIC
low complexity region	2420	2431	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128417

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132257

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150752

Predicted Effect

probably benign
Transcript: ENSMUST00000151563

SMART Domains

Protein: ENSMUSP00000116012
Gene: ENSMUSG00000006005

Domain	Start	End	E-Value	Type
coiled coil region	1	27	N/A	INTRINSIC
coiled coil region	79	235	N/A	INTRINSIC
low complexity region	302	324	N/A	INTRINSIC
low complexity region	368	384	N/A	INTRINSIC
low complexity region	527	540	N/A	INTRINSIC
low complexity region	549	588	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152967

Meta Mutation Damage Score

0.0825

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.7%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled-coil protein that forms intranuclear filaments attached to the inner surface of nuclear pore complexes (NPCs). The protein directly interacts with several components of the NPC. It is required for the nuclear export of mRNAs and some proteins. Oncogenic fusions of the 5' end of this gene with several different kinase genes occur in some neoplasias. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(28) : Targeted, other(2) Gene trapped(26)

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	G	T	10: 80,001,491	C403F	probably damaging	Het
Adam20	C	T	8: 40,796,109	Q419*	probably null	Het
Ankrd36	C	T	11: 5,646,876		probably benign	Het
Arl8b	T	A	6: 108,818,611	I170K	probably damaging	Het
Atp5f1	A	T	3: 105,954,172	V78E	possibly damaging	Het
Car9	G	T	4: 43,512,439		probably null	Het
Cgnl1	A	G	9: 71,726,058	Y4H	probably damaging	Het
Cnn2	T	C	10: 79,993,563	C176R	probably damaging	Het
Dst	A	G	1: 34,194,093	D3392G	probably damaging	Het
Eed	T	C	7: 89,967,811		probably benign	Het
Efl1	T	A	7: 82,763,013	V870E	possibly damaging	Het
Epx	T	C	11: 87,869,303	N495S	probably benign	Het
Fbxw20	T	A	9: 109,221,336	Y407F	probably benign	Het
Gbp9	T	A	5: 105,080,260	Q552L	probably benign	Het
Hspa13	C	A	16: 75,761,276	V134L	possibly damaging	Het
Il16	T	C	7: 83,674,538	N268S	probably damaging	Het
Kif14	G	A	1: 136,495,841		probably benign	Het
Lrig1	G	A	6: 94,622,602		probably benign	Het
Myo7a	T	A	7: 98,107,005	D29V	probably damaging	Het
Nsd2	A	G	5: 33,843,241	K34R	probably damaging	Het
Olfr1234	C	A	2: 89,363,179	L83F	possibly damaging	Het
P3h1	C	A	4: 119,237,907	T287K	probably damaging	Het
Pkhd1	A	T	1: 20,201,259	H3023Q	possibly damaging	Het
Plxna1	A	G	6: 89,342,960	L535P	probably damaging	Het
Ppp1r32	A	T	19: 10,479,460		probably benign	Het
Prom1	A	T	5: 44,029,714	S400R	probably benign	Het
Psap	T	G	10: 60,300,811	L523R	probably damaging	Het
Psme4	C	T	11: 30,804,310	T189I	probably damaging	Het
Ptpn12	A	T	5: 21,029,869	S39T	possibly damaging	Het
Qtrt2	T	A	16: 43,878,000	H98L	possibly damaging	Het
Rad54l2	C	A	9: 106,712,390	C601F	probably benign	Het
Sfswap	A	G	5: 129,554,576	K756R	possibly damaging	Het
Slc24a5	T	C	2: 125,068,907	V86A	probably damaging	Het
Srrm2	T	C	17: 23,822,540	S2575P	probably damaging	Het
Stam	T	C	2: 14,117,374		probably benign	Het
Tbx6	T	A	7: 126,783,192		probably benign	Het
Tmem131	A	C	1: 36,794,819	F1727V	probably damaging	Het
Trio	T	A	15: 27,871,171	H620L	probably damaging	Het
Uba5	T	C	9: 104,049,903	T292A	probably benign	Het
Unc5a	T	A	13: 54,990,952	V48E	possibly damaging	Het
Upf1	G	T	8: 70,338,906	H514Q	possibly damaging	Het
Usp9y	A	G	Y: 1,341,414		probably benign	Het
Vmn2r6	T	A	3: 64,556,840	D191V	probably benign	Het
Wapl	T	C	14: 34,691,906	Y242H	possibly damaging	Het
Zfp341	A	T	2: 154,646,052	N812Y	probably damaging	Het
Zfp358	C	A	8: 3,496,843	S475*	probably null	Het
Zfp957	C	A	14: 79,212,742	C539F	probably damaging	Het

Other mutations in Tpr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Tpr	APN	1	150423696	splice site	probably benign
IGL00424:Tpr	APN	1	150398595	splice site	probably benign
IGL01095:Tpr	APN	1	150410140	missense	possibly damaging	0.95
IGL01347:Tpr	APN	1	150426987	missense	probably damaging	1.00
IGL01519:Tpr	APN	1	150431168	missense	probably benign	0.01
IGL01768:Tpr	APN	1	150444448	missense	possibly damaging	0.85
IGL01939:Tpr	APN	1	150413745	missense	possibly damaging	0.82
IGL01988:Tpr	APN	1	150426999	splice site	probably null
IGL02065:Tpr	APN	1	150413774	missense	probably benign	0.13
IGL02110:Tpr	APN	1	150435742	missense	probably damaging	0.97
IGL02311:Tpr	APN	1	150398653	missense	probably damaging	0.97
IGL02454:Tpr	APN	1	150431192	missense	probably benign	0.00
IGL02569:Tpr	APN	1	150425631	unclassified	probably benign
IGL03168:Tpr	APN	1	150408757	missense	probably benign	0.04
IGL03193:Tpr	APN	1	150440080	missense	possibly damaging	0.85
IGL03333:Tpr	APN	1	150426967	missense	probably benign	0.04
Pouch	UTSW	1	150433772	missense	probably damaging	1.00
F6893:Tpr	UTSW	1	150393562	missense	possibly damaging	0.84
PIT4305001:Tpr	UTSW	1	150440137	missense	possibly damaging	0.85
PIT4469001:Tpr	UTSW	1	150403956	missense	probably benign	0.41
R0085:Tpr	UTSW	1	150417413	missense	possibly damaging	0.95
R0101:Tpr	UTSW	1	150409302	splice site	probably benign
R0116:Tpr	UTSW	1	150410147	missense	probably damaging	0.98
R0136:Tpr	UTSW	1	150430595	missense	probably benign	0.01
R0207:Tpr	UTSW	1	150417427	missense	possibly damaging	0.74
R0219:Tpr	UTSW	1	150443258	splice site	probably null
R0380:Tpr	UTSW	1	150412947	missense	probably benign	0.27
R0403:Tpr	UTSW	1	150407414	splice site	probably benign
R0469:Tpr	UTSW	1	150423667	frame shift	probably null
R0480:Tpr	UTSW	1	150428241	missense	possibly damaging	0.83
R0514:Tpr	UTSW	1	150402273	missense	possibly damaging	0.55
R0563:Tpr	UTSW	1	150408858	missense	probably benign	0.13
R0631:Tpr	UTSW	1	150422531	missense	probably damaging	0.98
R0685:Tpr	UTSW	1	150433725	missense	possibly damaging	0.69
R0730:Tpr	UTSW	1	150393407	utr 5 prime	probably benign
R0739:Tpr	UTSW	1	150407497	missense	possibly damaging	0.94
R0780:Tpr	UTSW	1	150431341	missense	probably benign	0.00
R1084:Tpr	UTSW	1	150442161	missense	probably benign	0.18
R1532:Tpr	UTSW	1	150418000	missense	probably damaging	0.99
R1551:Tpr	UTSW	1	150436801	missense	probably benign	0.00
R1608:Tpr	UTSW	1	150426893	missense	probably damaging	0.96
R1759:Tpr	UTSW	1	150429524	missense	probably benign	0.19
R1817:Tpr	UTSW	1	150419903	missense	probably damaging	0.98
R1932:Tpr	UTSW	1	150421663	missense	probably benign	0.00
R1978:Tpr	UTSW	1	150419907	missense	possibly damaging	0.65
R2031:Tpr	UTSW	1	150442119	missense	probably benign
R2176:Tpr	UTSW	1	150419940	missense	possibly damaging	0.56
R2235:Tpr	UTSW	1	150442092	missense	probably benign	0.33
R2339:Tpr	UTSW	1	150413774	missense	probably benign	0.01
R2367:Tpr	UTSW	1	150433728	missense	probably damaging	0.99
R2507:Tpr	UTSW	1	150392944	start codon destroyed	probably null
R3931:Tpr	UTSW	1	150435904	missense	probably damaging	1.00
R4320:Tpr	UTSW	1	150423574	missense	possibly damaging	0.96
R4439:Tpr	UTSW	1	150403961	missense	probably benign	0.01
R4568:Tpr	UTSW	1	150392959	unclassified	probably benign
R4644:Tpr	UTSW	1	150423499	missense	probably benign	0.01
R4665:Tpr	UTSW	1	150444399	missense	probably damaging	0.97
R4672:Tpr	UTSW	1	150423567	missense	probably benign	0.45
R4673:Tpr	UTSW	1	150423567	missense	probably benign	0.45
R4735:Tpr	UTSW	1	150442196	missense	possibly damaging	0.91
R4767:Tpr	UTSW	1	150430529	intron	probably benign
R4772:Tpr	UTSW	1	150413113	missense	possibly damaging	0.46
R4815:Tpr	UTSW	1	150398608	missense	probably benign	0.01
R4839:Tpr	UTSW	1	150449197	nonsense	probably null
R4844:Tpr	UTSW	1	150445879	missense	possibly damaging	0.86
R4925:Tpr	UTSW	1	150432565	missense	probably benign	0.00
R4967:Tpr	UTSW	1	150410059	missense	probably damaging	0.99
R5017:Tpr	UTSW	1	150398637	missense	probably benign	0.00
R5096:Tpr	UTSW	1	150446202	missense	probably damaging	0.99
R5353:Tpr	UTSW	1	150445924	missense	probably damaging	1.00
R5354:Tpr	UTSW	1	150445924	missense	probably damaging	1.00
R5484:Tpr	UTSW	1	150426888	missense	probably benign	0.33
R5601:Tpr	UTSW	1	150435853	missense	possibly damaging	0.75
R5642:Tpr	UTSW	1	150423818	missense	probably damaging	0.99
R5779:Tpr	UTSW	1	150423541	missense	probably damaging	1.00
R5787:Tpr	UTSW	1	150395286	missense	probably benign	0.01
R5892:Tpr	UTSW	1	150407400	missense	probably benign	0.44
R5915:Tpr	UTSW	1	150425649	missense	probably benign	0.15
R5928:Tpr	UTSW	1	150428127	missense	probably benign	0.30
R6146:Tpr	UTSW	1	150423162	missense	possibly damaging	0.83
R6154:Tpr	UTSW	1	150423816	missense	probably benign	0.00
R6234:Tpr	UTSW	1	150418039	missense	probably benign	0.02
R6263:Tpr	UTSW	1	150442245	critical splice donor site	probably null
R6318:Tpr	UTSW	1	150445888	missense	possibly damaging	0.93
R6550:Tpr	UTSW	1	150423977	missense	probably damaging	1.00
R6592:Tpr	UTSW	1	150411905	missense	possibly damaging	0.83
R6704:Tpr	UTSW	1	150406508	missense	possibly damaging	0.80
R6716:Tpr	UTSW	1	150414765	missense	probably damaging	1.00
R6836:Tpr	UTSW	1	150436673	splice site	probably null
R6886:Tpr	UTSW	1	150423965	missense	probably benign	0.00
R6894:Tpr	UTSW	1	150436847	missense	probably benign	0.28
R6928:Tpr	UTSW	1	150408785	missense	possibly damaging	0.83
R7011:Tpr	UTSW	1	150433772	missense	probably damaging	1.00
R7034:Tpr	UTSW	1	150423607	missense	probably benign	0.02
R7036:Tpr	UTSW	1	150423607	missense	probably benign	0.02
R7183:Tpr	UTSW	1	150406551	missense	probably damaging	1.00
R7221:Tpr	UTSW	1	150446178	missense	possibly damaging	0.96
R7223:Tpr	UTSW	1	150439256	missense	possibly damaging	0.53
R7294:Tpr	UTSW	1	150403887	missense	probably damaging	1.00
R7343:Tpr	UTSW	1	150393494	missense	unknown
R7361:Tpr	UTSW	1	150447621	missense	possibly damaging	0.73
R7405:Tpr	UTSW	1	150442127	missense	probably benign	0.02
R7637:Tpr	UTSW	1	150423516	missense	probably damaging	1.00
R7720:Tpr	UTSW	1	150429532	missense	possibly damaging	0.49
R7721:Tpr	UTSW	1	150444429	missense	probably benign
R7751:Tpr	UTSW	1	150419895	missense	probably benign	0.17
R7804:Tpr	UTSW	1	150432559	missense	probably damaging	0.99
R7878:Tpr	UTSW	1	150423660	missense	possibly damaging	0.67
R7973:Tpr	UTSW	1	150403887	missense	probably damaging	1.00
R8013:Tpr	UTSW	1	150398608	missense	probably benign
R8220:Tpr	UTSW	1	150432413	missense	probably benign	0.05
X0021:Tpr	UTSW	1	150395207	missense	probably damaging	1.00
Z1177:Tpr	UTSW	1	150428235	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGGCTTGGTTTCCAAACTGAAGTCTT -3'
(R):5'- ACTCCATGCTGAATACATAGGGTCACT -3'

Sequencing Primer
(F):5'- CCAAACTGAAGTCTTTCTTCCATAGG -3'
(R):5'- CTGTTACTAAGCCAGCTAAATGC -3'

Posted On

2014-01-05