Incidental Mutation 'R1018:Tpr'
ID 96531
Institutional Source Beutler Lab
Gene Symbol Tpr
Ensembl Gene ENSMUSG00000006005
Gene Name translocated promoter region, nuclear basket protein
Synonyms 2610029M07Rik
MMRRC Submission 039122-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1018 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 150268589-150325686 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 150317934 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 2147 (H2147Q)
Ref Sequence ENSEMBL: ENSMUSP00000117616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119161] [ENSMUST00000124484] [ENSMUST00000124973]
AlphaFold F6ZDS4
Predicted Effect possibly damaging
Transcript: ENSMUST00000119161
AA Change: H2073Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005
AA Change: H2073Q

DomainStartEndE-ValueType
coiled coil region 49 370 N/A INTRINSIC
coiled coil region 423 515 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
coiled coil region 539 604 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 782 795 N/A INTRINSIC
low complexity region 811 826 N/A INTRINSIC
low complexity region 1003 1019 N/A INTRINSIC
Pfam:TPR_MLP1_2 1036 1167 9.1e-33 PFAM
coiled coil region 1215 1421 N/A INTRINSIC
coiled coil region 1473 1629 N/A INTRINSIC
internal_repeat_3 1630 1691 1.48e-5 PROSPERO
low complexity region 1695 1717 N/A INTRINSIC
low complexity region 1761 1777 N/A INTRINSIC
internal_repeat_5 1814 1827 5.58e-5 PROSPERO
internal_repeat_3 1819 1881 1.48e-5 PROSPERO
internal_repeat_4 1875 1895 5.58e-5 PROSPERO
internal_repeat_1 1893 1919 2.03e-6 PROSPERO
low complexity region 1920 1933 N/A INTRINSIC
low complexity region 1942 1981 N/A INTRINSIC
low complexity region 1989 2014 N/A INTRINSIC
internal_repeat_4 2017 2036 5.58e-5 PROSPERO
low complexity region 2059 2078 N/A INTRINSIC
internal_repeat_2 2084 2135 3.95e-6 PROSPERO
internal_repeat_5 2127 2140 5.58e-5 PROSPERO
internal_repeat_1 2154 2179 2.03e-6 PROSPERO
internal_repeat_2 2156 2212 3.95e-6 PROSPERO
low complexity region 2239 2251 N/A INTRINSIC
low complexity region 2263 2277 N/A INTRINSIC
low complexity region 2292 2314 N/A INTRINSIC
low complexity region 2346 2357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124484
SMART Domains Protein: ENSMUSP00000121991
Gene: ENSMUSG00000006005

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
low complexity region 50 64 N/A INTRINSIC
low complexity region 79 101 N/A INTRINSIC
low complexity region 133 144 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124973
AA Change: H2147Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005
AA Change: H2147Q

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 24 77 N/A INTRINSIC
coiled coil region 123 444 N/A INTRINSIC
coiled coil region 497 589 N/A INTRINSIC
low complexity region 592 608 N/A INTRINSIC
coiled coil region 613 678 N/A INTRINSIC
low complexity region 764 777 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
Pfam:TPR_MLP1_2 1112 1240 5.1e-37 PFAM
coiled coil region 1289 1495 N/A INTRINSIC
low complexity region 1682 1698 N/A INTRINSIC
internal_repeat_5 1703 1750 8.04e-5 PROSPERO
internal_repeat_3 1704 1765 1.07e-5 PROSPERO
low complexity region 1769 1791 N/A INTRINSIC
low complexity region 1835 1851 N/A INTRINSIC
internal_repeat_5 1857 1900 8.04e-5 PROSPERO
internal_repeat_6 1887 1911 8.04e-5 PROSPERO
internal_repeat_3 1893 1955 1.07e-5 PROSPERO
internal_repeat_4 1949 1969 4.1e-5 PROSPERO
internal_repeat_1 1967 1993 1.42e-6 PROSPERO
low complexity region 1994 2007 N/A INTRINSIC
low complexity region 2016 2055 N/A INTRINSIC
low complexity region 2063 2088 N/A INTRINSIC
internal_repeat_4 2091 2110 4.1e-5 PROSPERO
internal_repeat_6 2108 2132 8.04e-5 PROSPERO
low complexity region 2133 2152 N/A INTRINSIC
internal_repeat_2 2158 2209 2.78e-6 PROSPERO
internal_repeat_1 2228 2253 1.42e-6 PROSPERO
internal_repeat_2 2230 2286 2.78e-6 PROSPERO
low complexity region 2313 2325 N/A INTRINSIC
low complexity region 2337 2351 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2420 2431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150752
Predicted Effect probably benign
Transcript: ENSMUST00000151563
SMART Domains Protein: ENSMUSP00000116012
Gene: ENSMUSG00000006005

DomainStartEndE-ValueType
coiled coil region 1 27 N/A INTRINSIC
coiled coil region 79 235 N/A INTRINSIC
low complexity region 302 324 N/A INTRINSIC
low complexity region 368 384 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 549 588 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152967
Meta Mutation Damage Score 0.0825 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled-coil protein that forms intranuclear filaments attached to the inner surface of nuclear pore complexes (NPCs). The protein directly interacts with several components of the NPC. It is required for the nuclear export of mRNAs and some proteins. Oncogenic fusions of the 5' end of this gene with several different kinase genes occur in some neoplasias. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(28) : Targeted, other(2) Gene trapped(26)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 79,837,325 (GRCm39) C403F probably damaging Het
Adam20 C T 8: 41,249,146 (GRCm39) Q419* probably null Het
Ankrd36 C T 11: 5,596,876 (GRCm39) probably benign Het
Arl8b T A 6: 108,795,572 (GRCm39) I170K probably damaging Het
Atp5pb A T 3: 105,861,488 (GRCm39) V78E possibly damaging Het
Car9 G T 4: 43,512,439 (GRCm39) probably null Het
Cgnl1 A G 9: 71,633,340 (GRCm39) Y4H probably damaging Het
Cnn2 T C 10: 79,829,397 (GRCm39) C176R probably damaging Het
Dst A G 1: 34,233,174 (GRCm39) D3392G probably damaging Het
Eed T C 7: 89,617,019 (GRCm39) probably benign Het
Efl1 T A 7: 82,412,221 (GRCm39) V870E possibly damaging Het
Epx T C 11: 87,760,129 (GRCm39) N495S probably benign Het
Fbxw20 T A 9: 109,050,404 (GRCm39) Y407F probably benign Het
Gbp9 T A 5: 105,228,126 (GRCm39) Q552L probably benign Het
Hspa13 C A 16: 75,558,164 (GRCm39) V134L possibly damaging Het
Il16 T C 7: 83,323,746 (GRCm39) N268S probably damaging Het
Kif14 G A 1: 136,423,579 (GRCm39) probably benign Het
Lrig1 G A 6: 94,599,583 (GRCm39) probably benign Het
Myo7a T A 7: 97,756,212 (GRCm39) D29V probably damaging Het
Nsd2 A G 5: 34,000,585 (GRCm39) K34R probably damaging Het
Or4a15 C A 2: 89,193,523 (GRCm39) L83F possibly damaging Het
P3h1 C A 4: 119,095,104 (GRCm39) T287K probably damaging Het
Pkhd1 A T 1: 20,271,483 (GRCm39) H3023Q possibly damaging Het
Plxna1 A G 6: 89,319,942 (GRCm39) L535P probably damaging Het
Prom1 A T 5: 44,187,056 (GRCm39) S400R probably benign Het
Psap T G 10: 60,136,590 (GRCm39) L523R probably damaging Het
Psme4 C T 11: 30,754,310 (GRCm39) T189I probably damaging Het
Ptpn12 A T 5: 21,234,867 (GRCm39) S39T possibly damaging Het
Qtrt2 T A 16: 43,698,363 (GRCm39) H98L possibly damaging Het
Rad54l2 C A 9: 106,589,589 (GRCm39) C601F probably benign Het
Saxo4 A T 19: 10,456,824 (GRCm39) probably benign Het
Sfswap A G 5: 129,631,640 (GRCm39) K756R possibly damaging Het
Slc24a5 T C 2: 124,910,827 (GRCm39) V86A probably damaging Het
Srrm2 T C 17: 24,041,514 (GRCm39) S2575P probably damaging Het
Stam T C 2: 14,122,185 (GRCm39) probably benign Het
Tbx6 T A 7: 126,382,364 (GRCm39) probably benign Het
Tmem131 A C 1: 36,833,900 (GRCm39) F1727V probably damaging Het
Trio T A 15: 27,871,257 (GRCm39) H620L probably damaging Het
Uba5 T C 9: 103,927,102 (GRCm39) T292A probably benign Het
Unc5a T A 13: 55,138,765 (GRCm39) V48E possibly damaging Het
Upf1 G T 8: 70,791,556 (GRCm39) H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 (GRCm39) probably benign Het
Vmn2r6 T A 3: 64,464,261 (GRCm39) D191V probably benign Het
Wapl T C 14: 34,413,863 (GRCm39) Y242H possibly damaging Het
Zfp341 A T 2: 154,487,972 (GRCm39) N812Y probably damaging Het
Zfp358 C A 8: 3,546,843 (GRCm39) S475* probably null Het
Zfp957 C A 14: 79,450,182 (GRCm39) C539F probably damaging Het
Other mutations in Tpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Tpr APN 1 150,299,447 (GRCm39) splice site probably benign
IGL00424:Tpr APN 1 150,274,346 (GRCm39) splice site probably benign
IGL01095:Tpr APN 1 150,285,891 (GRCm39) missense possibly damaging 0.95
IGL01347:Tpr APN 1 150,302,738 (GRCm39) missense probably damaging 1.00
IGL01519:Tpr APN 1 150,306,919 (GRCm39) missense probably benign 0.01
IGL01768:Tpr APN 1 150,320,199 (GRCm39) missense possibly damaging 0.85
IGL01939:Tpr APN 1 150,289,496 (GRCm39) missense possibly damaging 0.82
IGL01988:Tpr APN 1 150,302,750 (GRCm39) splice site probably null
IGL02065:Tpr APN 1 150,289,525 (GRCm39) missense probably benign 0.13
IGL02110:Tpr APN 1 150,311,493 (GRCm39) missense probably damaging 0.97
IGL02311:Tpr APN 1 150,274,404 (GRCm39) missense probably damaging 0.97
IGL02454:Tpr APN 1 150,306,943 (GRCm39) missense probably benign 0.00
IGL02569:Tpr APN 1 150,301,382 (GRCm39) unclassified probably benign
IGL03168:Tpr APN 1 150,284,508 (GRCm39) missense probably benign 0.04
IGL03193:Tpr APN 1 150,315,831 (GRCm39) missense possibly damaging 0.85
IGL03333:Tpr APN 1 150,302,718 (GRCm39) missense probably benign 0.04
gridiron UTSW 1 150,299,267 (GRCm39) missense probably damaging 1.00
Pouch UTSW 1 150,309,523 (GRCm39) missense probably damaging 1.00
punt UTSW 1 150,293,790 (GRCm39) missense probably benign 0.02
Turf UTSW 1 150,317,996 (GRCm39) critical splice donor site probably null
F6893:Tpr UTSW 1 150,269,313 (GRCm39) missense possibly damaging 0.84
PIT4305001:Tpr UTSW 1 150,315,888 (GRCm39) missense possibly damaging 0.85
PIT4469001:Tpr UTSW 1 150,279,707 (GRCm39) missense probably benign 0.41
R0085:Tpr UTSW 1 150,293,164 (GRCm39) missense possibly damaging 0.95
R0101:Tpr UTSW 1 150,285,053 (GRCm39) splice site probably benign
R0116:Tpr UTSW 1 150,285,898 (GRCm39) missense probably damaging 0.98
R0136:Tpr UTSW 1 150,306,346 (GRCm39) missense probably benign 0.01
R0207:Tpr UTSW 1 150,293,178 (GRCm39) missense possibly damaging 0.74
R0219:Tpr UTSW 1 150,319,009 (GRCm39) splice site probably null
R0380:Tpr UTSW 1 150,288,698 (GRCm39) missense probably benign 0.27
R0403:Tpr UTSW 1 150,283,165 (GRCm39) splice site probably benign
R0469:Tpr UTSW 1 150,299,418 (GRCm39) frame shift probably null
R0480:Tpr UTSW 1 150,303,992 (GRCm39) missense possibly damaging 0.83
R0514:Tpr UTSW 1 150,278,024 (GRCm39) missense possibly damaging 0.55
R0563:Tpr UTSW 1 150,284,609 (GRCm39) missense probably benign 0.13
R0631:Tpr UTSW 1 150,298,282 (GRCm39) missense probably damaging 0.98
R0685:Tpr UTSW 1 150,309,476 (GRCm39) missense possibly damaging 0.69
R0730:Tpr UTSW 1 150,269,158 (GRCm39) utr 5 prime probably benign
R0739:Tpr UTSW 1 150,283,248 (GRCm39) missense possibly damaging 0.94
R0780:Tpr UTSW 1 150,307,092 (GRCm39) missense probably benign 0.00
R1084:Tpr UTSW 1 150,317,912 (GRCm39) missense probably benign 0.18
R1532:Tpr UTSW 1 150,293,751 (GRCm39) missense probably damaging 0.99
R1551:Tpr UTSW 1 150,312,552 (GRCm39) missense probably benign 0.00
R1608:Tpr UTSW 1 150,302,644 (GRCm39) missense probably damaging 0.96
R1759:Tpr UTSW 1 150,305,275 (GRCm39) missense probably benign 0.19
R1817:Tpr UTSW 1 150,295,654 (GRCm39) missense probably damaging 0.98
R1932:Tpr UTSW 1 150,297,414 (GRCm39) missense probably benign 0.00
R1978:Tpr UTSW 1 150,295,658 (GRCm39) missense possibly damaging 0.65
R2031:Tpr UTSW 1 150,317,870 (GRCm39) missense probably benign
R2176:Tpr UTSW 1 150,295,691 (GRCm39) missense possibly damaging 0.56
R2235:Tpr UTSW 1 150,317,843 (GRCm39) missense probably benign 0.33
R2339:Tpr UTSW 1 150,289,525 (GRCm39) missense probably benign 0.01
R2367:Tpr UTSW 1 150,309,479 (GRCm39) missense probably damaging 0.99
R2507:Tpr UTSW 1 150,268,695 (GRCm39) start codon destroyed probably null
R3931:Tpr UTSW 1 150,311,655 (GRCm39) missense probably damaging 1.00
R4320:Tpr UTSW 1 150,299,325 (GRCm39) missense possibly damaging 0.96
R4439:Tpr UTSW 1 150,279,712 (GRCm39) missense probably benign 0.01
R4568:Tpr UTSW 1 150,268,710 (GRCm39) unclassified probably benign
R4644:Tpr UTSW 1 150,299,250 (GRCm39) missense probably benign 0.01
R4665:Tpr UTSW 1 150,320,150 (GRCm39) missense probably damaging 0.97
R4672:Tpr UTSW 1 150,299,318 (GRCm39) missense probably benign 0.45
R4673:Tpr UTSW 1 150,299,318 (GRCm39) missense probably benign 0.45
R4735:Tpr UTSW 1 150,317,947 (GRCm39) missense possibly damaging 0.91
R4767:Tpr UTSW 1 150,306,280 (GRCm39) intron probably benign
R4772:Tpr UTSW 1 150,288,864 (GRCm39) missense possibly damaging 0.46
R4815:Tpr UTSW 1 150,274,359 (GRCm39) missense probably benign 0.01
R4839:Tpr UTSW 1 150,324,948 (GRCm39) nonsense probably null
R4844:Tpr UTSW 1 150,321,630 (GRCm39) missense possibly damaging 0.86
R4925:Tpr UTSW 1 150,308,316 (GRCm39) missense probably benign 0.00
R4967:Tpr UTSW 1 150,285,810 (GRCm39) missense probably damaging 0.99
R5017:Tpr UTSW 1 150,274,388 (GRCm39) missense probably benign 0.00
R5096:Tpr UTSW 1 150,321,953 (GRCm39) missense probably damaging 0.99
R5353:Tpr UTSW 1 150,321,675 (GRCm39) missense probably damaging 1.00
R5354:Tpr UTSW 1 150,321,675 (GRCm39) missense probably damaging 1.00
R5484:Tpr UTSW 1 150,302,639 (GRCm39) missense probably benign 0.33
R5601:Tpr UTSW 1 150,311,604 (GRCm39) missense possibly damaging 0.75
R5642:Tpr UTSW 1 150,299,569 (GRCm39) missense probably damaging 0.99
R5779:Tpr UTSW 1 150,299,292 (GRCm39) missense probably damaging 1.00
R5787:Tpr UTSW 1 150,271,037 (GRCm39) missense probably benign 0.01
R5892:Tpr UTSW 1 150,283,151 (GRCm39) missense probably benign 0.44
R5915:Tpr UTSW 1 150,301,400 (GRCm39) missense probably benign 0.15
R5928:Tpr UTSW 1 150,303,878 (GRCm39) missense probably benign 0.30
R6146:Tpr UTSW 1 150,298,913 (GRCm39) missense possibly damaging 0.83
R6154:Tpr UTSW 1 150,299,567 (GRCm39) missense probably benign 0.00
R6234:Tpr UTSW 1 150,293,790 (GRCm39) missense probably benign 0.02
R6263:Tpr UTSW 1 150,317,996 (GRCm39) critical splice donor site probably null
R6318:Tpr UTSW 1 150,321,639 (GRCm39) missense possibly damaging 0.93
R6550:Tpr UTSW 1 150,299,728 (GRCm39) missense probably damaging 1.00
R6592:Tpr UTSW 1 150,287,656 (GRCm39) missense possibly damaging 0.83
R6704:Tpr UTSW 1 150,282,259 (GRCm39) missense possibly damaging 0.80
R6716:Tpr UTSW 1 150,290,516 (GRCm39) missense probably damaging 1.00
R6836:Tpr UTSW 1 150,312,424 (GRCm39) splice site probably null
R6886:Tpr UTSW 1 150,299,716 (GRCm39) missense probably benign 0.00
R6894:Tpr UTSW 1 150,312,598 (GRCm39) missense probably benign 0.28
R6928:Tpr UTSW 1 150,284,536 (GRCm39) missense possibly damaging 0.83
R7011:Tpr UTSW 1 150,309,523 (GRCm39) missense probably damaging 1.00
R7034:Tpr UTSW 1 150,299,358 (GRCm39) missense probably benign 0.02
R7036:Tpr UTSW 1 150,299,358 (GRCm39) missense probably benign 0.02
R7183:Tpr UTSW 1 150,282,302 (GRCm39) missense probably damaging 1.00
R7221:Tpr UTSW 1 150,321,929 (GRCm39) missense possibly damaging 0.96
R7223:Tpr UTSW 1 150,315,007 (GRCm39) missense possibly damaging 0.53
R7294:Tpr UTSW 1 150,279,638 (GRCm39) missense probably damaging 1.00
R7343:Tpr UTSW 1 150,269,245 (GRCm39) missense unknown
R7361:Tpr UTSW 1 150,323,372 (GRCm39) missense possibly damaging 0.73
R7405:Tpr UTSW 1 150,317,878 (GRCm39) missense probably benign 0.02
R7637:Tpr UTSW 1 150,299,267 (GRCm39) missense probably damaging 1.00
R7720:Tpr UTSW 1 150,305,283 (GRCm39) missense possibly damaging 0.49
R7721:Tpr UTSW 1 150,320,180 (GRCm39) missense probably benign
R7751:Tpr UTSW 1 150,295,646 (GRCm39) missense probably benign 0.17
R7804:Tpr UTSW 1 150,308,310 (GRCm39) missense probably damaging 0.99
R7878:Tpr UTSW 1 150,299,411 (GRCm39) missense possibly damaging 0.67
R7973:Tpr UTSW 1 150,279,638 (GRCm39) missense probably damaging 1.00
R8013:Tpr UTSW 1 150,274,359 (GRCm39) missense probably benign
R8220:Tpr UTSW 1 150,308,164 (GRCm39) missense probably benign 0.05
R8274:Tpr UTSW 1 150,299,230 (GRCm39) splice site probably benign
R8428:Tpr UTSW 1 150,290,564 (GRCm39) missense probably damaging 1.00
R8482:Tpr UTSW 1 150,309,451 (GRCm39) missense probably damaging 1.00
R8699:Tpr UTSW 1 150,293,772 (GRCm39) missense probably damaging 0.99
R8859:Tpr UTSW 1 150,284,597 (GRCm39) missense possibly damaging 0.90
R9119:Tpr UTSW 1 150,279,753 (GRCm39) missense probably damaging 0.99
R9326:Tpr UTSW 1 150,301,407 (GRCm39) missense possibly damaging 0.86
R9618:Tpr UTSW 1 150,321,979 (GRCm39) missense possibly damaging 0.70
R9680:Tpr UTSW 1 150,314,887 (GRCm39) missense probably benign 0.32
R9776:Tpr UTSW 1 150,324,939 (GRCm39) missense probably benign 0.00
X0021:Tpr UTSW 1 150,270,958 (GRCm39) missense probably damaging 1.00
Z1177:Tpr UTSW 1 150,303,986 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGCTTGGTTTCCAAACTGAAGTCTT -3'
(R):5'- ACTCCATGCTGAATACATAGGGTCACT -3'

Sequencing Primer
(F):5'- CCAAACTGAAGTCTTTCTTCCATAGG -3'
(R):5'- CTGTTACTAAGCCAGCTAAATGC -3'
Posted On 2014-01-05