Incidental Mutation 'R1018:Stam'
ID96535
Institutional Source Beutler Lab
Gene Symbol Stam
Ensembl Gene ENSMUSG00000026718
Gene Namesignal transducing adaptor molecule (SH3 domain and ITAM motif) 1
SynonymsSTAM1
MMRRC Submission 039122-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R1018 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location14074098-14149634 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 14117374 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028050] [ENSMUST00000102960] [ENSMUST00000138989] [ENSMUST00000193636]
Predicted Effect probably benign
Transcript: ENSMUST00000028050
SMART Domains Protein: ENSMUSP00000028050
Gene: ENSMUSG00000026718

DomainStartEndE-ValueType
VHS 9 139 1.87e-63 SMART
UIM 171 190 1.6e-2 SMART
SH3 213 268 8.29e-23 SMART
PDB:3F1I|C 301 377 9e-46 PDB
low complexity region 387 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102960
SMART Domains Protein: ENSMUSP00000100025
Gene: ENSMUSG00000026718

DomainStartEndE-ValueType
VHS 9 139 1.87e-63 SMART
UIM 171 190 1.6e-2 SMART
SH3 213 268 8.29e-23 SMART
Pfam:GAT 304 377 6.8e-10 PFAM
low complexity region 387 404 N/A INTRINSIC
low complexity region 482 501 N/A INTRINSIC
low complexity region 533 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138989
SMART Domains Protein: ENSMUSP00000121228
Gene: ENSMUSG00000026718

DomainStartEndE-ValueType
VHS 4 136 1.76e-59 SMART
UIM 168 187 1.6e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156901
Predicted Effect probably benign
Transcript: ENSMUST00000193636
SMART Domains Protein: ENSMUSP00000141207
Gene: ENSMUSG00000026718

DomainStartEndE-ValueType
Pfam:VHS 5 44 2e-8 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-transducing adaptor molecule family. These proteins mediate downstream signaling of cytokine receptors and also play a role in ER to Golgi trafficking by interacting with the coat protein II complex. The encoded protein also associates with hepatocyte growth factor-regulated substrate to form the endosomal sorting complex required for transport-0 (ESCRT-0), which sorts ubiquitinated membrane proteins to the ESCRT-1 complex for lysosomal degradation. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit progressive growth retardation, priapism, male infertility, degeneration of hippocapal CA3 pyramidal neurons and premature death, but exhibit normal lymphocyte development, proliferation and responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,001,491 C403F probably damaging Het
Adam20 C T 8: 40,796,109 Q419* probably null Het
Ankrd36 C T 11: 5,646,876 probably benign Het
Arl8b T A 6: 108,818,611 I170K probably damaging Het
Atp5f1 A T 3: 105,954,172 V78E possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cgnl1 A G 9: 71,726,058 Y4H probably damaging Het
Cnn2 T C 10: 79,993,563 C176R probably damaging Het
Dst A G 1: 34,194,093 D3392G probably damaging Het
Eed T C 7: 89,967,811 probably benign Het
Efl1 T A 7: 82,763,013 V870E possibly damaging Het
Epx T C 11: 87,869,303 N495S probably benign Het
Fbxw20 T A 9: 109,221,336 Y407F probably benign Het
Gbp9 T A 5: 105,080,260 Q552L probably benign Het
Hspa13 C A 16: 75,761,276 V134L possibly damaging Het
Il16 T C 7: 83,674,538 N268S probably damaging Het
Kif14 G A 1: 136,495,841 probably benign Het
Lrig1 G A 6: 94,622,602 probably benign Het
Myo7a T A 7: 98,107,005 D29V probably damaging Het
Nsd2 A G 5: 33,843,241 K34R probably damaging Het
Olfr1234 C A 2: 89,363,179 L83F possibly damaging Het
P3h1 C A 4: 119,237,907 T287K probably damaging Het
Pkhd1 A T 1: 20,201,259 H3023Q possibly damaging Het
Plxna1 A G 6: 89,342,960 L535P probably damaging Het
Ppp1r32 A T 19: 10,479,460 probably benign Het
Prom1 A T 5: 44,029,714 S400R probably benign Het
Psap T G 10: 60,300,811 L523R probably damaging Het
Psme4 C T 11: 30,804,310 T189I probably damaging Het
Ptpn12 A T 5: 21,029,869 S39T possibly damaging Het
Qtrt2 T A 16: 43,878,000 H98L possibly damaging Het
Rad54l2 C A 9: 106,712,390 C601F probably benign Het
Sfswap A G 5: 129,554,576 K756R possibly damaging Het
Slc24a5 T C 2: 125,068,907 V86A probably damaging Het
Srrm2 T C 17: 23,822,540 S2575P probably damaging Het
Tbx6 T A 7: 126,783,192 probably benign Het
Tmem131 A C 1: 36,794,819 F1727V probably damaging Het
Tpr T A 1: 150,442,183 H2147Q possibly damaging Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Uba5 T C 9: 104,049,903 T292A probably benign Het
Unc5a T A 13: 54,990,952 V48E possibly damaging Het
Upf1 G T 8: 70,338,906 H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 probably benign Het
Vmn2r6 T A 3: 64,556,840 D191V probably benign Het
Wapl T C 14: 34,691,906 Y242H possibly damaging Het
Zfp341 A T 2: 154,646,052 N812Y probably damaging Het
Zfp358 C A 8: 3,496,843 S475* probably null Het
Zfp957 C A 14: 79,212,742 C539F probably damaging Het
Other mutations in Stam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Stam APN 2 14115968 intron probably benign
IGL02964:Stam APN 2 14115968 intron probably benign
IGL03365:Stam APN 2 14146390 nonsense probably null
R0058:Stam UTSW 2 14138141 missense probably damaging 1.00
R0410:Stam UTSW 2 14138991 missense probably benign 0.04
R0479:Stam UTSW 2 14117495 missense probably damaging 1.00
R1554:Stam UTSW 2 14141828 missense probably benign
R1631:Stam UTSW 2 14146248 nonsense probably null
R1897:Stam UTSW 2 14129026 missense probably damaging 1.00
R3735:Stam UTSW 2 14129012 missense probably damaging 1.00
R3973:Stam UTSW 2 14138961 missense probably damaging 1.00
R4610:Stam UTSW 2 14115858 missense probably damaging 1.00
R4914:Stam UTSW 2 14102416 missense probably damaging 1.00
R5079:Stam UTSW 2 14074539 missense probably benign
R5209:Stam UTSW 2 14146347 missense probably benign 0.04
R5574:Stam UTSW 2 14115864 missense probably damaging 1.00
R5636:Stam UTSW 2 14117427 missense probably damaging 1.00
R6968:Stam UTSW 2 14116018 missense probably damaging 1.00
R7384:Stam UTSW 2 14134430 missense probably benign 0.17
R8127:Stam UTSW 2 14117473 missense probably damaging 0.99
Z1088:Stam UTSW 2 14139090 nonsense probably null
Z1176:Stam UTSW 2 14116013 missense probably damaging 1.00
Z1176:Stam UTSW 2 14128564 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGGCCAGATCTTTAGAAGGAGTTGC -3'
(R):5'- CCTGAGAGCCAATAGCTGGGAATG -3'

Sequencing Primer
(F):5'- GCCCCTAATATTGTGGCAAAG -3'
(R):5'- CCAATAGCTGGGAATGTTACAC -3'
Posted On2014-01-05