Incidental Mutation 'R1018:Olfr1234'
ID96537
Institutional Source Beutler Lab
Gene Symbol Olfr1234
Ensembl Gene ENSMUSG00000075090
Gene Nameolfactory receptor 1234
SynonymsMOR231-2, GA_x6K02T2Q125-50805620-50804676
MMRRC Submission 039122-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R1018 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89360013-89364865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 89363179 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 83 (L83F)
Ref Sequence ENSEMBL: ENSMUSP00000149303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099783] [ENSMUST00000111543] [ENSMUST00000137692]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099783
AA Change: L83F

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097371
Gene: ENSMUSG00000075090
AA Change: L83F

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 5.9e-32 PFAM
Pfam:7tm_4 137 278 1.5e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111543
AA Change: L83F

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107168
Gene: ENSMUSG00000075090
AA Change: L83F

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.2e-46 PFAM
Pfam:7tm_1 39 285 7.2e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000137692
AA Change: L83F

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,001,491 C403F probably damaging Het
Adam20 C T 8: 40,796,109 Q419* probably null Het
Ankrd36 C T 11: 5,646,876 probably benign Het
Arl8b T A 6: 108,818,611 I170K probably damaging Het
Atp5f1 A T 3: 105,954,172 V78E possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cgnl1 A G 9: 71,726,058 Y4H probably damaging Het
Cnn2 T C 10: 79,993,563 C176R probably damaging Het
Dst A G 1: 34,194,093 D3392G probably damaging Het
Eed T C 7: 89,967,811 probably benign Het
Efl1 T A 7: 82,763,013 V870E possibly damaging Het
Epx T C 11: 87,869,303 N495S probably benign Het
Fbxw20 T A 9: 109,221,336 Y407F probably benign Het
Gbp9 T A 5: 105,080,260 Q552L probably benign Het
Hspa13 C A 16: 75,761,276 V134L possibly damaging Het
Il16 T C 7: 83,674,538 N268S probably damaging Het
Kif14 G A 1: 136,495,841 probably benign Het
Lrig1 G A 6: 94,622,602 probably benign Het
Myo7a T A 7: 98,107,005 D29V probably damaging Het
Nsd2 A G 5: 33,843,241 K34R probably damaging Het
P3h1 C A 4: 119,237,907 T287K probably damaging Het
Pkhd1 A T 1: 20,201,259 H3023Q possibly damaging Het
Plxna1 A G 6: 89,342,960 L535P probably damaging Het
Ppp1r32 A T 19: 10,479,460 probably benign Het
Prom1 A T 5: 44,029,714 S400R probably benign Het
Psap T G 10: 60,300,811 L523R probably damaging Het
Psme4 C T 11: 30,804,310 T189I probably damaging Het
Ptpn12 A T 5: 21,029,869 S39T possibly damaging Het
Qtrt2 T A 16: 43,878,000 H98L possibly damaging Het
Rad54l2 C A 9: 106,712,390 C601F probably benign Het
Sfswap A G 5: 129,554,576 K756R possibly damaging Het
Slc24a5 T C 2: 125,068,907 V86A probably damaging Het
Srrm2 T C 17: 23,822,540 S2575P probably damaging Het
Stam T C 2: 14,117,374 probably benign Het
Tbx6 T A 7: 126,783,192 probably benign Het
Tmem131 A C 1: 36,794,819 F1727V probably damaging Het
Tpr T A 1: 150,442,183 H2147Q possibly damaging Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Uba5 T C 9: 104,049,903 T292A probably benign Het
Unc5a T A 13: 54,990,952 V48E possibly damaging Het
Upf1 G T 8: 70,338,906 H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 probably benign Het
Vmn2r6 T A 3: 64,556,840 D191V probably benign Het
Wapl T C 14: 34,691,906 Y242H possibly damaging Het
Zfp341 A T 2: 154,646,052 N812Y probably damaging Het
Zfp358 C A 8: 3,496,843 S475* probably null Het
Zfp957 C A 14: 79,212,742 C539F probably damaging Het
Other mutations in Olfr1234
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02134:Olfr1234 APN 2 89362828 missense probably damaging 0.97
R0945:Olfr1234 UTSW 2 89363255 missense probably damaging 0.98
R1419:Olfr1234 UTSW 2 89363322 missense probably damaging 1.00
R1872:Olfr1234 UTSW 2 89362589 missense probably damaging 1.00
R1929:Olfr1234 UTSW 2 89363009 missense probably benign 0.01
R2143:Olfr1234 UTSW 2 89363103 missense probably damaging 1.00
R3499:Olfr1234 UTSW 2 89362950 missense probably benign 0.07
R3776:Olfr1234 UTSW 2 89362764 missense possibly damaging 0.69
R4595:Olfr1234 UTSW 2 89363325 missense probably damaging 0.98
R6287:Olfr1234 UTSW 2 89363019 nonsense probably null
R7256:Olfr1234 UTSW 2 89362494 missense probably benign 0.21
R7516:Olfr1234 UTSW 2 89363375 missense probably benign 0.01
R7636:Olfr1234 UTSW 2 89363239 nonsense probably null
R8240:Olfr1234 UTSW 2 89362552 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGGTGACGGTACAAATTGCTCCTC -3'
(R):5'- TGGGCCTCACTCAGAATCCAGAAG -3'

Sequencing Primer
(F):5'- GTGCAAGCCAGTTTTAGCAG -3'
(R):5'- GCCAAAAGGTTCTGTTTGTCAC -3'
Posted On2014-01-05