Incidental Mutation 'R1110:Pkp4'
ID96544
Institutional Source Beutler Lab
Gene Symbol Pkp4
Ensembl Gene ENSMUSG00000026991
Gene Nameplakophilin 4
SynonymsArmrp, 9430019K17Rik, 5031422I09Rik, p0071
MMRRC Submission 039183-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1110 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location59160850-59355208 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59338765 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 752 (L752P)
Ref Sequence ENSEMBL: ENSMUSP00000129836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037903] [ENSMUST00000102754] [ENSMUST00000112577] [ENSMUST00000123908] [ENSMUST00000168631] [ENSMUST00000183359] [ENSMUST00000184332]
Predicted Effect probably damaging
Transcript: ENSMUST00000037903
AA Change: L768P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042249
Gene: ENSMUSG00000026991
AA Change: L768P

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 574 614 5.68e-9 SMART
ARM 618 659 1.61e-8 SMART
ARM 660 717 4.54e1 SMART
ARM 719 766 9.97e0 SMART
low complexity region 777 788 N/A INTRINSIC
ARM 876 916 3.34e-6 SMART
ARM 964 1008 1.32e-4 SMART
low complexity region 1057 1073 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102754
AA Change: L752P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099815
Gene: ENSMUSG00000026991
AA Change: L752P

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 558 598 5.68e-9 SMART
ARM 602 643 1.61e-8 SMART
ARM 644 701 4.54e1 SMART
ARM 703 750 9.97e0 SMART
low complexity region 761 772 N/A INTRINSIC
ARM 860 900 3.34e-6 SMART
ARM 948 992 1.32e-4 SMART
low complexity region 1083 1100 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112577
AA Change: L411P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108196
Gene: ENSMUSG00000026991
AA Change: L411P

DomainStartEndE-ValueType
low complexity region 126 137 N/A INTRINSIC
ARM 217 257 5.68e-9 SMART
ARM 261 302 1.61e-8 SMART
ARM 303 360 4.54e1 SMART
ARM 362 409 9.97e0 SMART
low complexity region 420 431 N/A INTRINSIC
ARM 519 559 3.34e-6 SMART
ARM 607 651 1.32e-4 SMART
low complexity region 742 759 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123908
AA Change: L768P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122152
Gene: ENSMUSG00000026991
AA Change: L768P

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 574 614 5.68e-9 SMART
ARM 618 659 1.61e-8 SMART
ARM 660 717 4.54e1 SMART
ARM 719 766 9.97e0 SMART
low complexity region 777 788 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151452
Predicted Effect probably damaging
Transcript: ENSMUST00000168631
AA Change: L752P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129836
Gene: ENSMUSG00000026991
AA Change: L752P

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 558 598 5.68e-9 SMART
ARM 602 643 1.61e-8 SMART
ARM 644 701 4.54e1 SMART
ARM 703 750 9.97e0 SMART
low complexity region 761 772 N/A INTRINSIC
ARM 860 900 3.34e-6 SMART
ARM 948 992 1.32e-4 SMART
low complexity region 1041 1057 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183359
SMART Domains Protein: ENSMUSP00000139141
Gene: ENSMUSG00000026991

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184332
Meta Mutation Damage Score 0.9218 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo-like proteins are characterized by a series of armadillo repeats, first defined in the Drosophila 'armadillo' gene product, that are typically 42 to 45 amino acids in length. These proteins can be divided into subfamilies based on their number of repeats, their overall sequence similarity, and the dispersion of the repeats throughout their sequences. Members of the p120(ctn)/plakophilin subfamily of Armadillo-like proteins, including CTNND1, CTNND2, PKP1, PKP2, PKP4, and ARVCF. PKP4 may be a component of desmosomal plaque and other adhesion plaques and is thought to be involved in regulating junctional plaque organization and cadherin function. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2015]
PHENOTYPE: An uncharacterized gene trap insertion does not result in an obvious phenotype during the observation period early in life, although abnormalities may still develop at older age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 T A 4: 155,905,399 probably null Het
Acp2 A G 2: 91,208,422 probably null Het
Akap13 T G 7: 75,611,377 S447A possibly damaging Het
Alk G A 17: 71,984,745 probably benign Het
Arhgef39 T C 4: 43,496,834 T327A probably benign Het
Cdan1 G A 2: 120,720,602 A1103V probably damaging Het
Cdh18 A G 15: 23,474,317 T758A probably benign Het
Cdk17 T A 10: 93,239,033 Y3* probably null Het
Cdon T C 9: 35,456,437 probably benign Het
Cntn3 T A 6: 102,245,158 N460I probably benign Het
Cntrl T A 2: 35,160,627 C985S possibly damaging Het
Col6a2 T C 10: 76,607,740 E497G probably benign Het
Crybg1 A G 10: 43,999,093 M673T possibly damaging Het
Cyp2u1 A G 3: 131,293,609 I441T possibly damaging Het
Disp2 T C 2: 118,790,439 S551P probably damaging Het
Dock2 A T 11: 34,256,535 F1354I possibly damaging Het
Dstyk A G 1: 132,453,325 probably benign Het
Dzip1 T C 14: 118,889,305 N527S probably benign Het
Eomes A G 9: 118,484,599 I571V probably benign Het
Fam26e T G 10: 34,096,017 I141L probably benign Het
Fbxl13 T C 5: 21,484,036 D758G probably benign Het
Frem1 T C 4: 82,950,320 S1457G probably damaging Het
Gabbr2 C T 4: 46,718,838 C613Y probably damaging Het
Gm906 A T 13: 50,248,260 D83E possibly damaging Het
Gm9755 A T 8: 67,515,058 noncoding transcript Het
Hnrnpul2 A G 19: 8,826,746 R570G probably damaging Het
Igdcc4 A G 9: 65,126,926 H674R possibly damaging Het
Kdm5d T A Y: 910,539 L250H probably damaging Het
Kif1a T C 1: 93,023,453 probably benign Het
Kmt2c T C 5: 25,314,362 N2250S probably benign Het
Kmt2e C T 5: 23,502,655 H1739Y probably damaging Het
Lmtk3 T A 7: 45,795,003 probably benign Het
Lpin3 A G 2: 160,894,079 D93G probably benign Het
Myh10 T C 11: 68,791,850 probably benign Het
Myom2 G A 8: 15,122,413 E1171K probably benign Het
Ncoa6 A T 2: 155,411,520 probably benign Het
Nup160 A G 2: 90,733,219 probably benign Het
Oit3 G A 10: 59,428,194 R373C probably damaging Het
Olfml2a A T 2: 38,959,753 I494L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Olfr824 A G 10: 130,126,653 Y135H probably damaging Het
Parp6 G T 9: 59,649,564 C584F probably damaging Het
Pcgf2 A G 11: 97,691,850 probably benign Het
Pde3a T C 6: 141,459,316 probably benign Het
Pibf1 C T 14: 99,112,973 R186C probably damaging Het
Pitrm1 A G 13: 6,558,244 D335G probably benign Het
Plcb3 C A 19: 6,961,913 E566* probably null Het
Prune2 T C 19: 17,125,222 S2582P probably benign Het
Reln A T 5: 22,034,775 D831E probably benign Het
Samd9l T A 6: 3,374,267 D998V probably benign Het
Sardh G A 2: 27,191,919 T865I possibly damaging Het
Setbp1 G A 18: 78,857,860 T864I probably damaging Het
Slc9a1 T A 4: 133,370,548 M2K probably benign Het
Sorbs2 A G 8: 45,795,730 T593A probably benign Het
Svs5 A T 2: 164,333,587 I120L probably benign Het
Tcl1b1 G T 12: 105,159,815 V19F probably damaging Het
Ttc30a1 A T 2: 75,979,976 C588S probably damaging Het
Urgcp T C 11: 5,716,004 N778S probably benign Het
Vnn1 A T 10: 23,899,601 I250F possibly damaging Het
Xntrpc A G 7: 102,082,974 R365G possibly damaging Het
Zfp84 T A 7: 29,771,372 M1K probably null Het
Zfyve26 G A 12: 79,280,067 R761C probably damaging Het
Zp3r A G 1: 130,577,884 probably null Het
Other mutations in Pkp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Pkp4 APN 2 59338755 missense probably damaging 0.99
IGL00987:Pkp4 APN 2 59308357 missense probably damaging 0.98
IGL01321:Pkp4 APN 2 59350627 splice site probably null
IGL01393:Pkp4 APN 2 59347925 missense probably damaging 1.00
IGL02058:Pkp4 APN 2 59311729 nonsense probably null
IGL02313:Pkp4 APN 2 59310254 nonsense probably null
IGL02635:Pkp4 APN 2 59305498 unclassified probably benign
IGL03017:Pkp4 APN 2 59266425 missense probably benign 0.06
IGL03051:Pkp4 APN 2 59311762 missense probably benign 0.29
Degrasso UTSW 2 59318600 missense probably damaging 1.00
melted UTSW 2 59334932 critical splice donor site probably null
R0206:Pkp4 UTSW 2 59266436 missense probably damaging 0.99
R0207:Pkp4 UTSW 2 59305488 missense possibly damaging 0.89
R0208:Pkp4 UTSW 2 59266436 missense probably damaging 0.99
R0325:Pkp4 UTSW 2 59318529 missense probably damaging 1.00
R0620:Pkp4 UTSW 2 59322643 missense possibly damaging 0.46
R0781:Pkp4 UTSW 2 59338765 missense probably damaging 1.00
R1537:Pkp4 UTSW 2 59214803 missense probably damaging 1.00
R1607:Pkp4 UTSW 2 59322554 missense probably benign 0.00
R1654:Pkp4 UTSW 2 59337619 missense probably damaging 0.96
R1760:Pkp4 UTSW 2 59311841 missense probably damaging 0.97
R2051:Pkp4 UTSW 2 59334904 missense probably benign 0.37
R2871:Pkp4 UTSW 2 59308156 missense probably benign 0.35
R2871:Pkp4 UTSW 2 59308156 missense probably benign 0.35
R3161:Pkp4 UTSW 2 59308105 missense probably damaging 1.00
R4261:Pkp4 UTSW 2 59305162 missense probably damaging 1.00
R4342:Pkp4 UTSW 2 59350608 missense probably damaging 0.98
R4731:Pkp4 UTSW 2 59334932 critical splice donor site probably null
R4799:Pkp4 UTSW 2 59342105 missense probably damaging 1.00
R4913:Pkp4 UTSW 2 59305450 missense probably damaging 1.00
R5383:Pkp4 UTSW 2 59310273 nonsense probably null
R5418:Pkp4 UTSW 2 59310162 missense probably benign 0.09
R5906:Pkp4 UTSW 2 59305076 missense possibly damaging 0.79
R5946:Pkp4 UTSW 2 59305067 missense probably benign 0.01
R6360:Pkp4 UTSW 2 59214747 missense probably benign 0.01
R6616:Pkp4 UTSW 2 59350552 nonsense probably null
R6817:Pkp4 UTSW 2 59318600 missense probably damaging 1.00
R7390:Pkp4 UTSW 2 59310140 missense possibly damaging 0.94
R7408:Pkp4 UTSW 2 59311766 missense probably damaging 1.00
R7464:Pkp4 UTSW 2 59308137 missense probably benign 0.12
R7702:Pkp4 UTSW 2 59308413 missense probably damaging 0.99
R7787:Pkp4 UTSW 2 59322537 missense probably damaging 0.98
R8055:Pkp4 UTSW 2 59308015 missense probably benign
Z1176:Pkp4 UTSW 2 59342244 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTAAAGCCAGTCCACGCTTCAC -3'
(R):5'- ATGGATGCCACAGCATCTCGACTC -3'

Sequencing Primer
(F):5'- CCCTCAAGACTGGAGAGCAG -3'
(R):5'- GAAACGGGTAAGCCCTCTG -3'
Posted On2014-01-05