Incidental Mutation 'R1018:Zfp341'
ID96549
Institutional Source Beutler Lab
Gene Symbol Zfp341
Ensembl Gene ENSMUSG00000059842
Gene Namezinc finger protein 341
Synonyms
MMRRC Submission 039122-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1018 (G1)
Quality Score150
Status Validated
Chromosome2
Chromosomal Location154613297-154646821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 154646052 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 812 (N812Y)
Ref Sequence ENSEMBL: ENSMUSP00000105324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081926] [ENSMUST00000109702] [ENSMUST00000126421]
Predicted Effect probably damaging
Transcript: ENSMUST00000081926
AA Change: N819Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080596
Gene: ENSMUSG00000059842
AA Change: N819Y

DomainStartEndE-ValueType
ZnF_C2H2 53 73 4.16e1 SMART
low complexity region 96 110 N/A INTRINSIC
low complexity region 154 161 N/A INTRINSIC
low complexity region 177 200 N/A INTRINSIC
ZnF_C2H2 320 342 3.69e-4 SMART
ZnF_C2H2 348 370 1.04e-3 SMART
ZnF_C2H2 442 464 1.45e-2 SMART
ZnF_C2H2 470 494 2.17e-1 SMART
ZnF_C2H2 500 522 2.91e-2 SMART
ZnF_C2H2 537 561 1.23e0 SMART
ZnF_C2H2 563 585 3.58e-2 SMART
ZnF_C2H2 591 613 1.62e0 SMART
ZnF_C2H2 619 641 2.27e-4 SMART
ZnF_C2H2 647 674 7.29e0 SMART
ZnF_C2H2 680 702 5.14e-3 SMART
low complexity region 740 759 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109702
AA Change: N812Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105324
Gene: ENSMUSG00000059842
AA Change: N812Y

DomainStartEndE-ValueType
ZnF_C2H2 53 73 4.16e1 SMART
low complexity region 96 110 N/A INTRINSIC
low complexity region 154 161 N/A INTRINSIC
low complexity region 177 200 N/A INTRINSIC
ZnF_C2H2 313 335 3.69e-4 SMART
ZnF_C2H2 341 363 1.04e-3 SMART
ZnF_C2H2 435 457 1.45e-2 SMART
ZnF_C2H2 463 487 2.17e-1 SMART
ZnF_C2H2 493 515 2.91e-2 SMART
ZnF_C2H2 530 554 1.23e0 SMART
ZnF_C2H2 556 578 3.58e-2 SMART
ZnF_C2H2 584 606 1.62e0 SMART
ZnF_C2H2 612 634 2.27e-4 SMART
ZnF_C2H2 640 667 7.29e0 SMART
ZnF_C2H2 673 695 5.14e-3 SMART
low complexity region 733 752 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126421
Meta Mutation Damage Score 0.4144 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,001,491 C403F probably damaging Het
Adam20 C T 8: 40,796,109 Q419* probably null Het
Ankrd36 C T 11: 5,646,876 probably benign Het
Arl8b T A 6: 108,818,611 I170K probably damaging Het
Atp5f1 A T 3: 105,954,172 V78E possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cgnl1 A G 9: 71,726,058 Y4H probably damaging Het
Cnn2 T C 10: 79,993,563 C176R probably damaging Het
Dst A G 1: 34,194,093 D3392G probably damaging Het
Eed T C 7: 89,967,811 probably benign Het
Efl1 T A 7: 82,763,013 V870E possibly damaging Het
Epx T C 11: 87,869,303 N495S probably benign Het
Fbxw20 T A 9: 109,221,336 Y407F probably benign Het
Gbp9 T A 5: 105,080,260 Q552L probably benign Het
Hspa13 C A 16: 75,761,276 V134L possibly damaging Het
Il16 T C 7: 83,674,538 N268S probably damaging Het
Kif14 G A 1: 136,495,841 probably benign Het
Lrig1 G A 6: 94,622,602 probably benign Het
Myo7a T A 7: 98,107,005 D29V probably damaging Het
Nsd2 A G 5: 33,843,241 K34R probably damaging Het
Olfr1234 C A 2: 89,363,179 L83F possibly damaging Het
P3h1 C A 4: 119,237,907 T287K probably damaging Het
Pkhd1 A T 1: 20,201,259 H3023Q possibly damaging Het
Plxna1 A G 6: 89,342,960 L535P probably damaging Het
Ppp1r32 A T 19: 10,479,460 probably benign Het
Prom1 A T 5: 44,029,714 S400R probably benign Het
Psap T G 10: 60,300,811 L523R probably damaging Het
Psme4 C T 11: 30,804,310 T189I probably damaging Het
Ptpn12 A T 5: 21,029,869 S39T possibly damaging Het
Qtrt2 T A 16: 43,878,000 H98L possibly damaging Het
Rad54l2 C A 9: 106,712,390 C601F probably benign Het
Sfswap A G 5: 129,554,576 K756R possibly damaging Het
Slc24a5 T C 2: 125,068,907 V86A probably damaging Het
Srrm2 T C 17: 23,822,540 S2575P probably damaging Het
Stam T C 2: 14,117,374 probably benign Het
Tbx6 T A 7: 126,783,192 probably benign Het
Tmem131 A C 1: 36,794,819 F1727V probably damaging Het
Tpr T A 1: 150,442,183 H2147Q possibly damaging Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Uba5 T C 9: 104,049,903 T292A probably benign Het
Unc5a T A 13: 54,990,952 V48E possibly damaging Het
Upf1 G T 8: 70,338,906 H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 probably benign Het
Vmn2r6 T A 3: 64,556,840 D191V probably benign Het
Wapl T C 14: 34,691,906 Y242H possibly damaging Het
Zfp358 C A 8: 3,496,843 S475* probably null Het
Zfp957 C A 14: 79,212,742 C539F probably damaging Het
Other mutations in Zfp341
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Zfp341 APN 2 154634231 missense probably damaging 1.00
IGL01352:Zfp341 APN 2 154628896 missense probably benign 0.00
IGL01748:Zfp341 APN 2 154628927 missense probably damaging 0.99
IGL02260:Zfp341 APN 2 154642049 missense possibly damaging 0.89
IGL02329:Zfp341 APN 2 154632304 missense possibly damaging 0.90
casanova_grimbacher UTSW 2 154624881 missense probably damaging 1.00
Specious UTSW 2 154646134 missense possibly damaging 0.63
R0079:Zfp341 UTSW 2 154624994 nonsense probably null
R0570:Zfp341 UTSW 2 154646068 missense probably benign 0.02
R0620:Zfp341 UTSW 2 154634273 missense possibly damaging 0.94
R1611:Zfp341 UTSW 2 154645703 missense probably damaging 1.00
R1733:Zfp341 UTSW 2 154641378 missense probably benign 0.19
R1822:Zfp341 UTSW 2 154646134 missense possibly damaging 0.63
R1956:Zfp341 UTSW 2 154638212 missense probably benign 0.09
R2437:Zfp341 UTSW 2 154628801 missense probably damaging 0.97
R3623:Zfp341 UTSW 2 154624881 missense probably damaging 1.00
R4417:Zfp341 UTSW 2 154628987 missense possibly damaging 0.94
R4806:Zfp341 UTSW 2 154645866 utr 3 prime probably benign
R4807:Zfp341 UTSW 2 154645866 utr 3 prime probably benign
R4863:Zfp341 UTSW 2 154645866 utr 3 prime probably benign
R4955:Zfp341 UTSW 2 154638030 missense probably damaging 0.98
R4962:Zfp341 UTSW 2 154626814 missense possibly damaging 0.80
R5484:Zfp341 UTSW 2 154625001 missense probably benign 0.00
R5864:Zfp341 UTSW 2 154643554 missense possibly damaging 0.95
R5877:Zfp341 UTSW 2 154632289 missense probably damaging 1.00
R5975:Zfp341 UTSW 2 154630441 missense probably damaging 1.00
R5990:Zfp341 UTSW 2 154645659 missense probably damaging 0.98
R6057:Zfp341 UTSW 2 154625034 missense probably benign 0.01
R6882:Zfp341 UTSW 2 154638023 missense probably damaging 1.00
R7686:Zfp341 UTSW 2 154624861 missense probably damaging 0.96
R7701:Zfp341 UTSW 2 154634080 splice site probably null
R7847:Zfp341 UTSW 2 154634194 missense probably damaging 1.00
R7930:Zfp341 UTSW 2 154634194 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCTTCTCACGACACAAATACCTC -3'
(R):5'- GGGCAAGGCTGATACAGTAACTTCC -3'

Sequencing Primer
(F):5'- TCAAGGATCACCGCTGC -3'
(R):5'- CAGTAACTTCCAAAAGGGATTGTGC -3'
Posted On2014-01-05