Incidental Mutation 'R1018:Atp5f1'
Institutional Source Beutler Lab
Gene Symbol Atp5f1
Ensembl Gene ENSMUSG00000000563
Gene NameATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1
MMRRC Submission 039122-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1018 (G1)
Quality Score225
Status Validated
Chromosomal Location105942698-105960099 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105954172 bp
Amino Acid Change Valine to Glutamic Acid at position 78 (V78E)
Ref Sequence ENSEMBL: ENSMUSP00000113022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118209] [ENSMUST00000133320]
Predicted Effect possibly damaging
Transcript: ENSMUST00000118209
AA Change: V78E

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113022
Gene: ENSMUSG00000000563
AA Change: V78E

Pfam:Mt_ATP-synt_B 83 244 2.5e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123959
Predicted Effect probably benign
Transcript: ENSMUST00000133320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153666
Predicted Effect unknown
Transcript: ENSMUST00000199311
AA Change: V3E
Meta Mutation Damage Score 0.2644 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the b subunit of the proton channel. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,001,491 C403F probably damaging Het
Adam20 C T 8: 40,796,109 Q419* probably null Het
Ankrd36 C T 11: 5,646,876 probably benign Het
Arl8b T A 6: 108,818,611 I170K probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cgnl1 A G 9: 71,726,058 Y4H probably damaging Het
Cnn2 T C 10: 79,993,563 C176R probably damaging Het
Dst A G 1: 34,194,093 D3392G probably damaging Het
Eed T C 7: 89,967,811 probably benign Het
Efl1 T A 7: 82,763,013 V870E possibly damaging Het
Epx T C 11: 87,869,303 N495S probably benign Het
Fbxw20 T A 9: 109,221,336 Y407F probably benign Het
Gbp9 T A 5: 105,080,260 Q552L probably benign Het
Hspa13 C A 16: 75,761,276 V134L possibly damaging Het
Il16 T C 7: 83,674,538 N268S probably damaging Het
Kif14 G A 1: 136,495,841 probably benign Het
Lrig1 G A 6: 94,622,602 probably benign Het
Myo7a T A 7: 98,107,005 D29V probably damaging Het
Nsd2 A G 5: 33,843,241 K34R probably damaging Het
Olfr1234 C A 2: 89,363,179 L83F possibly damaging Het
P3h1 C A 4: 119,237,907 T287K probably damaging Het
Pkhd1 A T 1: 20,201,259 H3023Q possibly damaging Het
Plxna1 A G 6: 89,342,960 L535P probably damaging Het
Ppp1r32 A T 19: 10,479,460 probably benign Het
Prom1 A T 5: 44,029,714 S400R probably benign Het
Psap T G 10: 60,300,811 L523R probably damaging Het
Psme4 C T 11: 30,804,310 T189I probably damaging Het
Ptpn12 A T 5: 21,029,869 S39T possibly damaging Het
Qtrt2 T A 16: 43,878,000 H98L possibly damaging Het
Rad54l2 C A 9: 106,712,390 C601F probably benign Het
Sfswap A G 5: 129,554,576 K756R possibly damaging Het
Slc24a5 T C 2: 125,068,907 V86A probably damaging Het
Srrm2 T C 17: 23,822,540 S2575P probably damaging Het
Stam T C 2: 14,117,374 probably benign Het
Tbx6 T A 7: 126,783,192 probably benign Het
Tmem131 A C 1: 36,794,819 F1727V probably damaging Het
Tpr T A 1: 150,442,183 H2147Q possibly damaging Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Uba5 T C 9: 104,049,903 T292A probably benign Het
Unc5a T A 13: 54,990,952 V48E possibly damaging Het
Upf1 G T 8: 70,338,906 H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 probably benign Het
Vmn2r6 T A 3: 64,556,840 D191V probably benign Het
Wapl T C 14: 34,691,906 Y242H possibly damaging Het
Zfp341 A T 2: 154,646,052 N812Y probably damaging Het
Zfp358 C A 8: 3,496,843 S475* probably null Het
Zfp957 C A 14: 79,212,742 C539F probably damaging Het
Other mutations in Atp5f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1763:Atp5f1 UTSW 3 105951589 critical splice donor site probably null
R2045:Atp5f1 UTSW 3 105943874 intron probably benign
R5213:Atp5f1 UTSW 3 105955911 nonsense probably null
R7051:Atp5f1 UTSW 3 105943767 missense probably benign 0.07
R7426:Atp5f1 UTSW 3 105943802 missense probably benign 0.11
R7812:Atp5f1 UTSW 3 105943841 missense probably benign 0.10
R7896:Atp5f1 UTSW 3 105955943 missense probably damaging 1.00
R8218:Atp5f1 UTSW 3 105959186 start codon destroyed probably null 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- acgtgcttcacatttacattatttc -3'
Posted On2014-01-05