Incidental Mutation 'R1018:P3h1'
List |< first << previous [record 22 of 48] next >> last >|
ID96559
Institutional Source Beutler Lab
Gene Symbol P3h1
Ensembl Gene ENSMUSG00000028641
Gene Nameprolyl 3-hydroxylase 1
SynonymsLepre1, Gros1, 2410024C15Rik
MMRRC Submission 039122-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1018 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location119232915-119248975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 119237907 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 287 (T287K)
Ref Sequence ENSEMBL: ENSMUSP00000119695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030393] [ENSMUST00000081606] [ENSMUST00000102662] [ENSMUST00000121111] [ENSMUST00000136278]
Predicted Effect probably benign
Transcript: ENSMUST00000030393
AA Change: T287K

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000030393
Gene: ENSMUSG00000028641
AA Change: T287K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 60 84 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
internal_repeat_1 136 213 2.49e-12 PROSPERO
internal_repeat_1 294 369 2.49e-12 PROSPERO
Blast:P4Hc 419 462 2e-14 BLAST
P4Hc 479 687 5.96e-53 SMART
low complexity region 714 725 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000081606
AA Change: T108K

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080312
Gene: ENSMUSG00000028641
AA Change: T108K

DomainStartEndE-ValueType
SCOP:d1hxia_ 80 195 4e-5 SMART
Blast:P4Hc 125 206 2e-11 BLAST
Blast:P4Hc 233 276 1e-14 BLAST
P4Hc 293 501 5.96e-53 SMART
low complexity region 528 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102662
AA Change: T287K

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099723
Gene: ENSMUSG00000028641
AA Change: T287K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 60 84 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
internal_repeat_1 136 213 1.9e-12 PROSPERO
internal_repeat_1 294 369 1.9e-12 PROSPERO
Blast:P4Hc 412 455 2e-14 BLAST
P4Hc 472 680 5.96e-53 SMART
low complexity region 707 718 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121111
AA Change: T287K

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112504
Gene: ENSMUSG00000028641
AA Change: T287K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 60 84 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
internal_repeat_1 136 213 2.32e-12 PROSPERO
internal_repeat_1 294 369 2.32e-12 PROSPERO
Blast:P4Hc 412 455 2e-14 BLAST
P4Hc 472 680 5.96e-53 SMART
low complexity region 707 718 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131875
Predicted Effect probably damaging
Transcript: ENSMUST00000136278
AA Change: T287K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119695
Gene: ENSMUSG00000028641
AA Change: T287K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 60 84 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
internal_repeat_1 136 198 6.76e-13 PROSPERO
internal_repeat_1 294 356 6.76e-13 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153940
Meta Mutation Damage Score 0.1229 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that is a member of the collagen prolyl hydroxylase family. These enzymes are localized to the endoplasmic reticulum and their activity is required for proper collagen synthesis and assembly. Mutations in this gene are associated with osteogenesis imperfecta type VIII. Three alternatively spliced transcript variants encoding different isoforms have been described. Other variants may exist, but their biological validity has not been determined. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced size, disproportional reduction in long bone length, decreased bone density, decreased bone mineral density, reduced body fat, delayed ossification, and abnormal collagen networks in the skin and tendons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,001,491 C403F probably damaging Het
Adam20 C T 8: 40,796,109 Q419* probably null Het
Ankrd36 C T 11: 5,646,876 probably benign Het
Arl8b T A 6: 108,818,611 I170K probably damaging Het
Atp5f1 A T 3: 105,954,172 V78E possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cgnl1 A G 9: 71,726,058 Y4H probably damaging Het
Cnn2 T C 10: 79,993,563 C176R probably damaging Het
Dst A G 1: 34,194,093 D3392G probably damaging Het
Eed T C 7: 89,967,811 probably benign Het
Efl1 T A 7: 82,763,013 V870E possibly damaging Het
Epx T C 11: 87,869,303 N495S probably benign Het
Fbxw20 T A 9: 109,221,336 Y407F probably benign Het
Gbp9 T A 5: 105,080,260 Q552L probably benign Het
Hspa13 C A 16: 75,761,276 V134L possibly damaging Het
Il16 T C 7: 83,674,538 N268S probably damaging Het
Kif14 G A 1: 136,495,841 probably benign Het
Lrig1 G A 6: 94,622,602 probably benign Het
Myo7a T A 7: 98,107,005 D29V probably damaging Het
Nsd2 A G 5: 33,843,241 K34R probably damaging Het
Olfr1234 C A 2: 89,363,179 L83F possibly damaging Het
Pkhd1 A T 1: 20,201,259 H3023Q possibly damaging Het
Plxna1 A G 6: 89,342,960 L535P probably damaging Het
Ppp1r32 A T 19: 10,479,460 probably benign Het
Prom1 A T 5: 44,029,714 S400R probably benign Het
Psap T G 10: 60,300,811 L523R probably damaging Het
Psme4 C T 11: 30,804,310 T189I probably damaging Het
Ptpn12 A T 5: 21,029,869 S39T possibly damaging Het
Qtrt2 T A 16: 43,878,000 H98L possibly damaging Het
Rad54l2 C A 9: 106,712,390 C601F probably benign Het
Sfswap A G 5: 129,554,576 K756R possibly damaging Het
Slc24a5 T C 2: 125,068,907 V86A probably damaging Het
Srrm2 T C 17: 23,822,540 S2575P probably damaging Het
Stam T C 2: 14,117,374 probably benign Het
Tbx6 T A 7: 126,783,192 probably benign Het
Tmem131 A C 1: 36,794,819 F1727V probably damaging Het
Tpr T A 1: 150,442,183 H2147Q possibly damaging Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Uba5 T C 9: 104,049,903 T292A probably benign Het
Unc5a T A 13: 54,990,952 V48E possibly damaging Het
Upf1 G T 8: 70,338,906 H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 probably benign Het
Vmn2r6 T A 3: 64,556,840 D191V probably benign Het
Wapl T C 14: 34,691,906 Y242H possibly damaging Het
Zfp341 A T 2: 154,646,052 N812Y probably damaging Het
Zfp358 C A 8: 3,496,843 S475* probably null Het
Zfp957 C A 14: 79,212,742 C539F probably damaging Het
Other mutations in P3h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:P3h1 APN 4 119235283 missense probably damaging 1.00
IGL01623:P3h1 APN 4 119235283 missense probably damaging 1.00
IGL01645:P3h1 APN 4 119236783 missense probably damaging 1.00
IGL02140:P3h1 APN 4 119237865 missense probably damaging 1.00
IGL02415:P3h1 APN 4 119247955 missense probably benign
IGL02543:P3h1 APN 4 119237856 splice site probably benign
IGL02870:P3h1 APN 4 119247571 missense probably damaging 1.00
IGL02972:P3h1 APN 4 119247960 missense possibly damaging 0.75
IGL03067:P3h1 APN 4 119235280 missense probably damaging 0.99
IGL03077:P3h1 APN 4 119236786 missense probably damaging 1.00
woohoo UTSW 4 119241132 nonsense probably null
R0194:P3h1 UTSW 4 119237952 missense probably damaging 1.00
R0523:P3h1 UTSW 4 119241530 missense probably benign 0.32
R0734:P3h1 UTSW 4 119238688 missense probably damaging 1.00
R0944:P3h1 UTSW 4 119238759 missense probably benign 0.00
R1978:P3h1 UTSW 4 119247976 missense probably null 0.00
R2697:P3h1 UTSW 4 119247180 missense probably damaging 1.00
R5668:P3h1 UTSW 4 119244046 missense possibly damaging 0.89
R5750:P3h1 UTSW 4 119238666 missense probably damaging 0.96
R5965:P3h1 UTSW 4 119248227 missense probably benign 0.00
R5987:P3h1 UTSW 4 119246665 missense probably damaging 1.00
R6111:P3h1 UTSW 4 119241132 nonsense probably null
R6786:P3h1 UTSW 4 119237954 missense possibly damaging 0.65
R7142:P3h1 UTSW 4 119247161 missense probably benign 0.00
R8068:P3h1 UTSW 4 119236862 missense probably damaging 1.00
R8304:P3h1 UTSW 4 119247205 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCACACATGCCACATACTTGCAC -3'
(R):5'- GCTTGTGACAAAACACCCAGGAATC -3'

Sequencing Primer
(F):5'- tcaggaggcagaggcag -3'
(R):5'- ACCCAGGAATCATTGGGC -3'
Posted On2014-01-05