Incidental Mutation 'R1110:Ncoa6'
ID96560
Institutional Source Beutler Lab
Gene Symbol Ncoa6
Ensembl Gene ENSMUSG00000038369
Gene Namenuclear receptor coactivator 6
SynonymsPRIP, ASC-2, NRC, AIB3, RAP250, ASC2
MMRRC Submission 039183-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1110 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location155390656-155473894 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 155411520 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043126] [ENSMUST00000109670] [ENSMUST00000123293]
Predicted Effect probably benign
Transcript: ENSMUST00000043126
SMART Domains Protein: ENSMUSP00000045386
Gene: ENSMUSG00000038369

DomainStartEndE-ValueType
Pfam:Nucleic_acid_bd 47 190 3.3e-55 PFAM
coiled coil region 256 296 N/A INTRINSIC
low complexity region 375 383 N/A INTRINSIC
internal_repeat_1 450 597 3.31e-5 PROSPERO
low complexity region 615 630 N/A INTRINSIC
internal_repeat_1 636 793 3.31e-5 PROSPERO
low complexity region 844 860 N/A INTRINSIC
low complexity region 909 931 N/A INTRINSIC
low complexity region 986 998 N/A INTRINSIC
low complexity region 1002 1046 N/A INTRINSIC
low complexity region 1126 1139 N/A INTRINSIC
low complexity region 1258 1273 N/A INTRINSIC
low complexity region 1328 1351 N/A INTRINSIC
low complexity region 1543 1564 N/A INTRINSIC
low complexity region 1578 1599 N/A INTRINSIC
low complexity region 1607 1618 N/A INTRINSIC
low complexity region 1808 1825 N/A INTRINSIC
low complexity region 1894 1908 N/A INTRINSIC
low complexity region 2043 2053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109670
SMART Domains Protein: ENSMUSP00000105295
Gene: ENSMUSG00000038369

DomainStartEndE-ValueType
Pfam:Nucleic_acid_bd 45 195 3.6e-60 PFAM
coiled coil region 256 296 N/A INTRINSIC
low complexity region 375 383 N/A INTRINSIC
internal_repeat_1 450 597 3.31e-5 PROSPERO
low complexity region 615 630 N/A INTRINSIC
internal_repeat_1 636 793 3.31e-5 PROSPERO
low complexity region 844 860 N/A INTRINSIC
low complexity region 909 931 N/A INTRINSIC
low complexity region 986 998 N/A INTRINSIC
low complexity region 1002 1046 N/A INTRINSIC
low complexity region 1126 1139 N/A INTRINSIC
low complexity region 1258 1273 N/A INTRINSIC
low complexity region 1328 1351 N/A INTRINSIC
low complexity region 1543 1564 N/A INTRINSIC
low complexity region 1578 1599 N/A INTRINSIC
low complexity region 1607 1618 N/A INTRINSIC
low complexity region 1808 1825 N/A INTRINSIC
low complexity region 1894 1908 N/A INTRINSIC
low complexity region 2043 2053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123293
SMART Domains Protein: ENSMUSP00000118113
Gene: ENSMUSG00000038369

DomainStartEndE-ValueType
Pfam:Nucleic_acid_bd 45 195 2.4e-60 PFAM
coiled coil region 256 296 N/A INTRINSIC
low complexity region 375 383 N/A INTRINSIC
low complexity region 564 573 N/A INTRINSIC
low complexity region 615 630 N/A INTRINSIC
low complexity region 844 860 N/A INTRINSIC
low complexity region 909 931 N/A INTRINSIC
low complexity region 986 998 N/A INTRINSIC
low complexity region 1002 1046 N/A INTRINSIC
low complexity region 1126 1139 N/A INTRINSIC
low complexity region 1258 1273 N/A INTRINSIC
low complexity region 1328 1351 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141928
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 97% (63/65)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit retarded embryonic growth and defects of the placenta, heart, liver, and nervous system. Mutants die around midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 T A 4: 155,905,399 probably null Het
Acp2 A G 2: 91,208,422 probably null Het
Akap13 T G 7: 75,611,377 S447A possibly damaging Het
Alk G A 17: 71,984,745 probably benign Het
Arhgef39 T C 4: 43,496,834 T327A probably benign Het
Cdan1 G A 2: 120,720,602 A1103V probably damaging Het
Cdh18 A G 15: 23,474,317 T758A probably benign Het
Cdk17 T A 10: 93,239,033 Y3* probably null Het
Cdon T C 9: 35,456,437 probably benign Het
Cntn3 T A 6: 102,245,158 N460I probably benign Het
Cntrl T A 2: 35,160,627 C985S possibly damaging Het
Col6a2 T C 10: 76,607,740 E497G probably benign Het
Crybg1 A G 10: 43,999,093 M673T possibly damaging Het
Cyp2u1 A G 3: 131,293,609 I441T possibly damaging Het
Disp2 T C 2: 118,790,439 S551P probably damaging Het
Dock2 A T 11: 34,256,535 F1354I possibly damaging Het
Dstyk A G 1: 132,453,325 probably benign Het
Dzip1 T C 14: 118,889,305 N527S probably benign Het
Eomes A G 9: 118,484,599 I571V probably benign Het
Fam26e T G 10: 34,096,017 I141L probably benign Het
Fbxl13 T C 5: 21,484,036 D758G probably benign Het
Frem1 T C 4: 82,950,320 S1457G probably damaging Het
Gabbr2 C T 4: 46,718,838 C613Y probably damaging Het
Gm906 A T 13: 50,248,260 D83E possibly damaging Het
Gm9755 A T 8: 67,515,058 noncoding transcript Het
Hnrnpul2 A G 19: 8,826,746 R570G probably damaging Het
Igdcc4 A G 9: 65,126,926 H674R possibly damaging Het
Kdm5d T A Y: 910,539 L250H probably damaging Het
Kif1a T C 1: 93,023,453 probably benign Het
Kmt2c T C 5: 25,314,362 N2250S probably benign Het
Kmt2e C T 5: 23,502,655 H1739Y probably damaging Het
Lmtk3 T A 7: 45,795,003 probably benign Het
Lpin3 A G 2: 160,894,079 D93G probably benign Het
Myh10 T C 11: 68,791,850 probably benign Het
Myom2 G A 8: 15,122,413 E1171K probably benign Het
Nup160 A G 2: 90,733,219 probably benign Het
Oit3 G A 10: 59,428,194 R373C probably damaging Het
Olfml2a A T 2: 38,959,753 I494L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Olfr824 A G 10: 130,126,653 Y135H probably damaging Het
Parp6 G T 9: 59,649,564 C584F probably damaging Het
Pcgf2 A G 11: 97,691,850 probably benign Het
Pde3a T C 6: 141,459,316 probably benign Het
Pibf1 C T 14: 99,112,973 R186C probably damaging Het
Pitrm1 A G 13: 6,558,244 D335G probably benign Het
Pkp4 T C 2: 59,338,765 L752P probably damaging Het
Plcb3 C A 19: 6,961,913 E566* probably null Het
Prune2 T C 19: 17,125,222 S2582P probably benign Het
Reln A T 5: 22,034,775 D831E probably benign Het
Samd9l T A 6: 3,374,267 D998V probably benign Het
Sardh G A 2: 27,191,919 T865I possibly damaging Het
Setbp1 G A 18: 78,857,860 T864I probably damaging Het
Slc9a1 T A 4: 133,370,548 M2K probably benign Het
Sorbs2 A G 8: 45,795,730 T593A probably benign Het
Svs5 A T 2: 164,333,587 I120L probably benign Het
Tcl1b1 G T 12: 105,159,815 V19F probably damaging Het
Ttc30a1 A T 2: 75,979,976 C588S probably damaging Het
Urgcp T C 11: 5,716,004 N778S probably benign Het
Vnn1 A T 10: 23,899,601 I250F possibly damaging Het
Xntrpc A G 7: 102,082,974 R365G possibly damaging Het
Zfp84 T A 7: 29,771,372 M1K probably null Het
Zfyve26 G A 12: 79,280,067 R761C probably damaging Het
Zp3r A G 1: 130,577,884 probably null Het
Other mutations in Ncoa6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Ncoa6 APN 2 155406208 missense probably damaging 0.99
IGL00849:Ncoa6 APN 2 155421688 missense possibly damaging 0.89
IGL00933:Ncoa6 APN 2 155415397 missense probably damaging 1.00
IGL00981:Ncoa6 APN 2 155406179 missense probably damaging 0.98
IGL01420:Ncoa6 APN 2 155407587 missense probably damaging 1.00
IGL02160:Ncoa6 APN 2 155421083 missense possibly damaging 0.65
IGL03049:Ncoa6 APN 2 155419014 missense probably damaging 1.00
IGL03194:Ncoa6 APN 2 155415868 missense possibly damaging 0.94
IGL03269:Ncoa6 APN 2 155406489 missense probably damaging 0.97
IGL03299:Ncoa6 APN 2 155407287 missense probably damaging 0.97
IGL03306:Ncoa6 APN 2 155405507 missense probably benign 0.30
alcoa UTSW 2 155402664 unclassified probably benign
Aluminum UTSW 2 155399693 critical splice acceptor site probably null
balboa UTSW 2 155406949 missense probably benign 0.05
mauna_loa UTSW 2 155415227 missense probably damaging 0.99
PIT4466001:Ncoa6 UTSW 2 155405657 missense probably benign
R0011:Ncoa6 UTSW 2 155408291 frame shift probably null
R0014:Ncoa6 UTSW 2 155438043 missense possibly damaging 0.86
R0079:Ncoa6 UTSW 2 155408291 frame shift probably null
R0080:Ncoa6 UTSW 2 155408291 frame shift probably null
R0081:Ncoa6 UTSW 2 155408291 frame shift probably null
R0164:Ncoa6 UTSW 2 155408291 frame shift probably null
R0166:Ncoa6 UTSW 2 155408291 frame shift probably null
R0172:Ncoa6 UTSW 2 155408291 frame shift probably null
R0173:Ncoa6 UTSW 2 155408291 frame shift probably null
R0245:Ncoa6 UTSW 2 155391211 missense probably benign 0.00
R0284:Ncoa6 UTSW 2 155408291 frame shift probably null
R0285:Ncoa6 UTSW 2 155408291 frame shift probably null
R0285:Ncoa6 UTSW 2 155415701 missense probably damaging 0.96
R0288:Ncoa6 UTSW 2 155408291 frame shift probably null
R0539:Ncoa6 UTSW 2 155415697 missense probably benign 0.08
R0652:Ncoa6 UTSW 2 155391211 missense probably benign 0.00
R0781:Ncoa6 UTSW 2 155411520 splice site probably benign
R1053:Ncoa6 UTSW 2 155434040 missense probably damaging 1.00
R1420:Ncoa6 UTSW 2 155421153 nonsense probably null
R1521:Ncoa6 UTSW 2 155415222 missense possibly damaging 0.78
R1541:Ncoa6 UTSW 2 155415304 missense probably benign 0.35
R1677:Ncoa6 UTSW 2 155402664 unclassified probably benign
R1858:Ncoa6 UTSW 2 155421639 missense probably benign 0.13
R1954:Ncoa6 UTSW 2 155406821 missense possibly damaging 0.94
R1955:Ncoa6 UTSW 2 155406821 missense possibly damaging 0.94
R2040:Ncoa6 UTSW 2 155406080 missense probably damaging 0.98
R2087:Ncoa6 UTSW 2 155406159 nonsense probably null
R2159:Ncoa6 UTSW 2 155407713 missense probably damaging 1.00
R2278:Ncoa6 UTSW 2 155407650 missense possibly damaging 0.94
R2696:Ncoa6 UTSW 2 155438015 missense probably benign 0.45
R2891:Ncoa6 UTSW 2 155437961 missense possibly damaging 0.86
R3618:Ncoa6 UTSW 2 155407789 missense possibly damaging 0.95
R3747:Ncoa6 UTSW 2 155411641 missense probably benign 0.01
R3778:Ncoa6 UTSW 2 155421195 missense probably damaging 1.00
R3784:Ncoa6 UTSW 2 155407757 missense probably damaging 1.00
R3802:Ncoa6 UTSW 2 155405564 missense probably benign
R3820:Ncoa6 UTSW 2 155406938 missense probably damaging 1.00
R3821:Ncoa6 UTSW 2 155406938 missense probably damaging 1.00
R3822:Ncoa6 UTSW 2 155406938 missense probably damaging 1.00
R3870:Ncoa6 UTSW 2 155415557 unclassified probably null
R4037:Ncoa6 UTSW 2 155407370 missense probably damaging 0.98
R4488:Ncoa6 UTSW 2 155407476 missense possibly damaging 0.94
R4719:Ncoa6 UTSW 2 155391161 unclassified probably benign
R4732:Ncoa6 UTSW 2 155421301 missense probably damaging 1.00
R4733:Ncoa6 UTSW 2 155421301 missense probably damaging 1.00
R4829:Ncoa6 UTSW 2 155415227 missense probably damaging 0.99
R4835:Ncoa6 UTSW 2 155407133 missense possibly damaging 0.46
R4883:Ncoa6 UTSW 2 155406767 missense probably benign 0.29
R4967:Ncoa6 UTSW 2 155421332 missense possibly damaging 0.80
R5021:Ncoa6 UTSW 2 155406949 missense probably benign 0.05
R5234:Ncoa6 UTSW 2 155438013 missense probably benign 0.01
R5356:Ncoa6 UTSW 2 155421192 missense probably damaging 0.99
R5358:Ncoa6 UTSW 2 155406987 missense probably damaging 0.97
R5375:Ncoa6 UTSW 2 155433995 missense probably benign 0.16
R5412:Ncoa6 UTSW 2 155407781 missense possibly damaging 0.95
R5579:Ncoa6 UTSW 2 155406677 missense probably damaging 1.00
R5618:Ncoa6 UTSW 2 155437897 missense possibly damaging 0.86
R5641:Ncoa6 UTSW 2 155421836 missense probably benign 0.22
R5757:Ncoa6 UTSW 2 155411608 missense probably damaging 1.00
R5761:Ncoa6 UTSW 2 155408141 missense probably benign 0.11
R5778:Ncoa6 UTSW 2 155406768 missense probably benign 0.01
R5852:Ncoa6 UTSW 2 155405499 missense possibly damaging 0.88
R5940:Ncoa6 UTSW 2 155415865 missense probably damaging 0.98
R6155:Ncoa6 UTSW 2 155407448 missense probably damaging 1.00
R6374:Ncoa6 UTSW 2 155421156 missense probably damaging 1.00
R6389:Ncoa6 UTSW 2 155395816 missense probably damaging 0.98
R6669:Ncoa6 UTSW 2 155399693 critical splice acceptor site probably null
R7097:Ncoa6 UTSW 2 155438063 missense probably benign 0.01
R7385:Ncoa6 UTSW 2 155407801 missense probably damaging 1.00
RF033:Ncoa6 UTSW 2 155421731 small deletion probably benign
RF040:Ncoa6 UTSW 2 155421731 small deletion probably benign
RF048:Ncoa6 UTSW 2 155421712 small deletion probably benign
X0017:Ncoa6 UTSW 2 155406540 missense probably benign 0.05
Z1176:Ncoa6 UTSW 2 155421302 missense probably damaging 0.99
Z1177:Ncoa6 UTSW 2 155406142 missense possibly damaging 0.67
Z1177:Ncoa6 UTSW 2 155421218 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTAGTTCTCTGCTTTGAAAACGTC -3'
(R):5'- GAGGTTGCACTAGATTCCTGTGTTCC -3'

Sequencing Primer
(F):5'- AGGCACTTTGCACTAAGTCTG -3'
(R):5'- AGATTCCTGTGTTCCTTATACAGC -3'
Posted On2014-01-05