Incidental Mutation 'R1018:Ptpn12'
List |< first << previous [record 29 of 48] next >> last >|
ID96563
Institutional Source Beutler Lab
Gene Symbol Ptpn12
Ensembl Gene ENSMUSG00000028771
Gene Nameprotein tyrosine phosphatase, non-receptor type 12
SynonymsP19-PTP, PTP-PEST, PTP-P19
MMRRC Submission 039122-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1018 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location20986645-21055911 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21029869 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 39 (S39T)
Ref Sequence ENSEMBL: ENSMUSP00000030556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030556] [ENSMUST00000151813] [ENSMUST00000199774]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030556
AA Change: S39T

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030556
Gene: ENSMUSG00000028771
AA Change: S39T

DomainStartEndE-ValueType
PTPc 27 295 2.14e-126 SMART
Blast:PTPc 338 399 7e-12 BLAST
low complexity region 499 518 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
low complexity region 622 640 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140057
Predicted Effect probably benign
Transcript: ENSMUST00000151813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196295
Predicted Effect probably benign
Transcript: ENSMUST00000199774
Meta Mutation Damage Score 0.3904 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains a C-terminal PEST motif, which serves as a protein-protein interaction domain, and may regulate protein intracellular half-life. This PTP was found to bind and dephosphorylate the product of the oncogene c-ABL and thus may play a role in oncogenesis. This PTP was also shown to interact with, and dephosphorylate, various products related to cytoskeletal structure and cell adhesion, such as p130 (Cas), CAKbeta/PTK2B, PSTPIP1, and paxillin. This suggests it has a regulatory role in controlling cell shape and mobility. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene results in early embryonic lethality, defective embryo turning, improper somitogenesis and vasculogenesis, impaired liver development, truncation of the caudal region and mesenchyme deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,001,491 C403F probably damaging Het
Adam20 C T 8: 40,796,109 Q419* probably null Het
Ankrd36 C T 11: 5,646,876 probably benign Het
Arl8b T A 6: 108,818,611 I170K probably damaging Het
Atp5f1 A T 3: 105,954,172 V78E possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cgnl1 A G 9: 71,726,058 Y4H probably damaging Het
Cnn2 T C 10: 79,993,563 C176R probably damaging Het
Dst A G 1: 34,194,093 D3392G probably damaging Het
Eed T C 7: 89,967,811 probably benign Het
Efl1 T A 7: 82,763,013 V870E possibly damaging Het
Epx T C 11: 87,869,303 N495S probably benign Het
Fbxw20 T A 9: 109,221,336 Y407F probably benign Het
Gbp9 T A 5: 105,080,260 Q552L probably benign Het
Hspa13 C A 16: 75,761,276 V134L possibly damaging Het
Il16 T C 7: 83,674,538 N268S probably damaging Het
Kif14 G A 1: 136,495,841 probably benign Het
Lrig1 G A 6: 94,622,602 probably benign Het
Myo7a T A 7: 98,107,005 D29V probably damaging Het
Nsd2 A G 5: 33,843,241 K34R probably damaging Het
Olfr1234 C A 2: 89,363,179 L83F possibly damaging Het
P3h1 C A 4: 119,237,907 T287K probably damaging Het
Pkhd1 A T 1: 20,201,259 H3023Q possibly damaging Het
Plxna1 A G 6: 89,342,960 L535P probably damaging Het
Ppp1r32 A T 19: 10,479,460 probably benign Het
Prom1 A T 5: 44,029,714 S400R probably benign Het
Psap T G 10: 60,300,811 L523R probably damaging Het
Psme4 C T 11: 30,804,310 T189I probably damaging Het
Qtrt2 T A 16: 43,878,000 H98L possibly damaging Het
Rad54l2 C A 9: 106,712,390 C601F probably benign Het
Sfswap A G 5: 129,554,576 K756R possibly damaging Het
Slc24a5 T C 2: 125,068,907 V86A probably damaging Het
Srrm2 T C 17: 23,822,540 S2575P probably damaging Het
Stam T C 2: 14,117,374 probably benign Het
Tbx6 T A 7: 126,783,192 probably benign Het
Tmem131 A C 1: 36,794,819 F1727V probably damaging Het
Tpr T A 1: 150,442,183 H2147Q possibly damaging Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Uba5 T C 9: 104,049,903 T292A probably benign Het
Unc5a T A 13: 54,990,952 V48E possibly damaging Het
Upf1 G T 8: 70,338,906 H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 probably benign Het
Vmn2r6 T A 3: 64,556,840 D191V probably benign Het
Wapl T C 14: 34,691,906 Y242H possibly damaging Het
Zfp341 A T 2: 154,646,052 N812Y probably damaging Het
Zfp358 C A 8: 3,496,843 S475* probably null Het
Zfp957 C A 14: 79,212,742 C539F probably damaging Het
Other mutations in Ptpn12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Ptpn12 APN 5 21029850 missense probably damaging 1.00
IGL00226:Ptpn12 APN 5 20998668 missense probably damaging 1.00
IGL01432:Ptpn12 APN 5 20998555 nonsense probably null
IGL02285:Ptpn12 APN 5 21055713 missense probably benign 0.40
IGL02488:Ptpn12 APN 5 21022062 missense possibly damaging 0.72
IGL02550:Ptpn12 APN 5 20998139 missense probably benign 0.00
IGL02640:Ptpn12 APN 5 21019246 missense probably damaging 1.00
IGL02652:Ptpn12 APN 5 21002437 missense probably benign 0.04
IGL03130:Ptpn12 APN 5 21002612 unclassified probably benign
R0531:Ptpn12 UTSW 5 20998483 missense possibly damaging 0.53
R0948:Ptpn12 UTSW 5 20998043 missense probably benign
R1184:Ptpn12 UTSW 5 20998356 missense possibly damaging 0.86
R1699:Ptpn12 UTSW 5 20998170 missense probably benign 0.01
R1938:Ptpn12 UTSW 5 20993263 missense probably damaging 1.00
R1952:Ptpn12 UTSW 5 20998310 missense probably benign 0.34
R2152:Ptpn12 UTSW 5 21002468 missense probably damaging 1.00
R2153:Ptpn12 UTSW 5 21002468 missense probably damaging 1.00
R2154:Ptpn12 UTSW 5 21002468 missense probably damaging 1.00
R2267:Ptpn12 UTSW 5 20998411 missense probably damaging 0.98
R2358:Ptpn12 UTSW 5 20998692 missense probably damaging 1.00
R3551:Ptpn12 UTSW 5 20989049 missense possibly damaging 0.67
R3931:Ptpn12 UTSW 5 21001323 missense probably benign 0.00
R4013:Ptpn12 UTSW 5 20992743 missense probably benign 0.05
R4039:Ptpn12 UTSW 5 21002510 nonsense probably null
R4501:Ptpn12 UTSW 5 21019280 missense probably damaging 1.00
R4748:Ptpn12 UTSW 5 21005385 nonsense probably null
R4754:Ptpn12 UTSW 5 20998589 missense probably benign 0.34
R4963:Ptpn12 UTSW 5 21015708 splice site probably null
R5160:Ptpn12 UTSW 5 20997831 missense probably damaging 1.00
R5581:Ptpn12 UTSW 5 21015726 missense probably damaging 1.00
R5789:Ptpn12 UTSW 5 20989015 missense possibly damaging 0.92
R5836:Ptpn12 UTSW 5 21009546 nonsense probably null
R6383:Ptpn12 UTSW 5 20987468 nonsense probably null
R6883:Ptpn12 UTSW 5 21055713 missense probably benign 0.40
R7544:Ptpn12 UTSW 5 21009511 missense probably damaging 1.00
R7885:Ptpn12 UTSW 5 20998525 missense possibly damaging 0.54
R8032:Ptpn12 UTSW 5 20998043 missense probably benign
R8224:Ptpn12 UTSW 5 20998658 missense probably damaging 1.00
X0004:Ptpn12 UTSW 5 21019296 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCCACGAGAAGAAACGGAGTC -3'
(R):5'- TTTGAGAGAGCCTGGCACATCCTG -3'

Sequencing Primer
(F):5'- CCTTAGCTATTCAGTTCAGGAACAG -3'
(R):5'- AGGGGAAACCTGTGCTTAATTC -3'
Posted On2014-01-05