Incidental Mutation 'R1018:Prom1'
List |< first << previous [record 26 of 48] next >> last >|
ID96567
Institutional Source Beutler Lab
Gene Symbol Prom1
Ensembl Gene ENSMUSG00000029086
Gene Nameprominin 1
Synonyms4932416E19Rik, Prom, AC133, CD133, Prom-1
MMRRC Submission 039122-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R1018 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location43993620-44102032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44029714 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 400 (S400R)
Ref Sequence ENSEMBL: ENSMUSP00000137557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030973] [ENSMUST00000074113] [ENSMUST00000087441] [ENSMUST00000087442] [ENSMUST00000165909] [ENSMUST00000171543] [ENSMUST00000177946] [ENSMUST00000179059] [ENSMUST00000197706] [ENSMUST00000197750]
Predicted Effect probably benign
Transcript: ENSMUST00000030973
AA Change: S366R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000030973
Gene: ENSMUSG00000029086
AA Change: S366R

DomainStartEndE-ValueType
Pfam:Prominin 11 326 1.5e-113 PFAM
Pfam:Prominin 322 798 4.6e-188 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074113
AA Change: S400R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000073751
Gene: ENSMUSG00000029086
AA Change: S400R

DomainStartEndE-ValueType
low complexity region 8 13 N/A INTRINSIC
Pfam:Prominin 18 822 2e-294 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087441
AA Change: S391R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000084707
Gene: ENSMUSG00000029086
AA Change: S391R

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087442
AA Change: S391R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000084709
Gene: ENSMUSG00000029086
AA Change: S391R

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165909
AA Change: S391R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000129909
Gene: ENSMUSG00000029086
AA Change: S391R

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171543
AA Change: S400R

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000128978
Gene: ENSMUSG00000029086
AA Change: S400R

DomainStartEndE-ValueType
Pfam:Prominin 11 838 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177946
AA Change: S391R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000136483
Gene: ENSMUSG00000029086
AA Change: S391R

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179059
AA Change: S400R

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000137557
Gene: ENSMUSG00000029086
AA Change: S400R

DomainStartEndE-ValueType
Pfam:Prominin 11 838 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196853
Predicted Effect probably benign
Transcript: ENSMUST00000197706
AA Change: S361R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000142632
Gene: ENSMUSG00000029086
AA Change: S361R

DomainStartEndE-ValueType
Pfam:Prominin 11 321 6.6e-110 PFAM
Pfam:Prominin 317 793 6.8e-188 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197749
Predicted Effect probably benign
Transcript: ENSMUST00000197750
AA Change: S391R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000142375
Gene: ENSMUSG00000029086
AA Change: S391R

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199739
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pentaspan transmembrane glycoprotein. The protein localizes to membrane protrusions and is often expressed on adult stem cells, where it is thought to function in maintaining stem cell properties by suppressing differentiation. Mutations in this gene have been shown to result in retinitis pigmentosa and Stargardt disease. Expression of this gene is also associated with several types of cancer. This gene is expressed from at least five alternative promoters that are expressed in a tissue-dependent manner. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal retina morphology, vasculature, and electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,001,491 C403F probably damaging Het
Adam20 C T 8: 40,796,109 Q419* probably null Het
Ankrd36 C T 11: 5,646,876 probably benign Het
Arl8b T A 6: 108,818,611 I170K probably damaging Het
Atp5f1 A T 3: 105,954,172 V78E possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cgnl1 A G 9: 71,726,058 Y4H probably damaging Het
Cnn2 T C 10: 79,993,563 C176R probably damaging Het
Dst A G 1: 34,194,093 D3392G probably damaging Het
Eed T C 7: 89,967,811 probably benign Het
Efl1 T A 7: 82,763,013 V870E possibly damaging Het
Epx T C 11: 87,869,303 N495S probably benign Het
Fbxw20 T A 9: 109,221,336 Y407F probably benign Het
Gbp9 T A 5: 105,080,260 Q552L probably benign Het
Hspa13 C A 16: 75,761,276 V134L possibly damaging Het
Il16 T C 7: 83,674,538 N268S probably damaging Het
Kif14 G A 1: 136,495,841 probably benign Het
Lrig1 G A 6: 94,622,602 probably benign Het
Myo7a T A 7: 98,107,005 D29V probably damaging Het
Nsd2 A G 5: 33,843,241 K34R probably damaging Het
Olfr1234 C A 2: 89,363,179 L83F possibly damaging Het
P3h1 C A 4: 119,237,907 T287K probably damaging Het
Pkhd1 A T 1: 20,201,259 H3023Q possibly damaging Het
Plxna1 A G 6: 89,342,960 L535P probably damaging Het
Ppp1r32 A T 19: 10,479,460 probably benign Het
Psap T G 10: 60,300,811 L523R probably damaging Het
Psme4 C T 11: 30,804,310 T189I probably damaging Het
Ptpn12 A T 5: 21,029,869 S39T possibly damaging Het
Qtrt2 T A 16: 43,878,000 H98L possibly damaging Het
Rad54l2 C A 9: 106,712,390 C601F probably benign Het
Sfswap A G 5: 129,554,576 K756R possibly damaging Het
Slc24a5 T C 2: 125,068,907 V86A probably damaging Het
Srrm2 T C 17: 23,822,540 S2575P probably damaging Het
Stam T C 2: 14,117,374 probably benign Het
Tbx6 T A 7: 126,783,192 probably benign Het
Tmem131 A C 1: 36,794,819 F1727V probably damaging Het
Tpr T A 1: 150,442,183 H2147Q possibly damaging Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Uba5 T C 9: 104,049,903 T292A probably benign Het
Unc5a T A 13: 54,990,952 V48E possibly damaging Het
Upf1 G T 8: 70,338,906 H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 probably benign Het
Vmn2r6 T A 3: 64,556,840 D191V probably benign Het
Wapl T C 14: 34,691,906 Y242H possibly damaging Het
Zfp341 A T 2: 154,646,052 N812Y probably damaging Het
Zfp358 C A 8: 3,496,843 S475* probably null Het
Zfp957 C A 14: 79,212,742 C539F probably damaging Het
Other mutations in Prom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Prom1 APN 5 44055937 missense probably damaging 1.00
IGL00392:Prom1 APN 5 44007021 critical splice donor site probably null
IGL00771:Prom1 APN 5 44029776 splice site probably benign
IGL00841:Prom1 APN 5 44063116 splice site probably benign
IGL01780:Prom1 APN 5 44029604 splice site probably benign
IGL01991:Prom1 APN 5 44047506 missense probably benign 0.13
IGL02220:Prom1 APN 5 44014789 missense probably damaging 1.00
IGL02350:Prom1 APN 5 44029604 splice site probably benign
IGL02357:Prom1 APN 5 44029604 splice site probably benign
IGL02420:Prom1 APN 5 44063154 missense probably benign 0.15
IGL02468:Prom1 APN 5 44029698 missense probably benign 0.01
IGL02633:Prom1 APN 5 44014775 missense probably benign 0.20
IGL02871:Prom1 APN 5 44029676 missense probably damaging 1.00
IGL02967:Prom1 APN 5 44044398 missense probably damaging 1.00
IGL03033:Prom1 APN 5 44006160 splice site probably null
IGL03072:Prom1 APN 5 44058662 intron probably benign
IGL03149:Prom1 APN 5 44029734 missense probably damaging 0.99
IGL03277:Prom1 APN 5 44032971 nonsense probably null
BB001:Prom1 UTSW 5 44029769 missense not run
BB011:Prom1 UTSW 5 44029769 missense not run
R1456:Prom1 UTSW 5 44037623 missense probably damaging 0.96
R1458:Prom1 UTSW 5 44032932 splice site probably benign
R1536:Prom1 UTSW 5 44018353 missense probably benign 0.39
R1747:Prom1 UTSW 5 44007031 missense probably benign 0.03
R1772:Prom1 UTSW 5 44011224 missense probably benign 0.00
R2020:Prom1 UTSW 5 44011253 splice site probably benign
R2022:Prom1 UTSW 5 44029726 missense probably benign 0.18
R2091:Prom1 UTSW 5 44014086 splice site probably benign
R2163:Prom1 UTSW 5 44014163 missense possibly damaging 0.72
R2177:Prom1 UTSW 5 44026739 missense possibly damaging 0.67
R3015:Prom1 UTSW 5 44034391 missense probably damaging 1.00
R3022:Prom1 UTSW 5 44047574 missense probably damaging 1.00
R4824:Prom1 UTSW 5 44034390 missense probably damaging 0.98
R4909:Prom1 UTSW 5 44045552 missense probably benign 0.00
R4999:Prom1 UTSW 5 44037534 missense probably benign 0.00
R5082:Prom1 UTSW 5 44000832 unclassified probably null
R5351:Prom1 UTSW 5 44044355 missense probably damaging 1.00
R5401:Prom1 UTSW 5 44000805 missense probably damaging 0.99
R5440:Prom1 UTSW 5 44058646 missense probably benign
R5529:Prom1 UTSW 5 44026768 missense probably damaging 1.00
R5537:Prom1 UTSW 5 44000776 critical splice donor site probably null
R5669:Prom1 UTSW 5 44012943 missense possibly damaging 0.64
R5723:Prom1 UTSW 5 44014894 missense probably benign 0.30
R5778:Prom1 UTSW 5 44007047 missense probably benign 0.13
R5924:Prom1 UTSW 5 44004963 missense probably benign 0.02
R6034:Prom1 UTSW 5 44044408 critical splice acceptor site probably null
R6034:Prom1 UTSW 5 44044408 critical splice acceptor site probably null
R6038:Prom1 UTSW 5 44001793 missense probably damaging 1.00
R6038:Prom1 UTSW 5 44001793 missense probably damaging 1.00
R6145:Prom1 UTSW 5 44029649 missense probably benign 0.05
R6374:Prom1 UTSW 5 44055983 missense probably damaging 1.00
R6542:Prom1 UTSW 5 44037509 missense possibly damaging 0.84
R6645:Prom1 UTSW 5 44047514 missense probably damaging 0.98
R7158:Prom1 UTSW 5 44012913 missense probably damaging 1.00
R7233:Prom1 UTSW 5 44037474 missense possibly damaging 0.90
R7244:Prom1 UTSW 5 44020900 missense probably benign 0.03
R7339:Prom1 UTSW 5 44101653 unclassified probably benign
R7365:Prom1 UTSW 5 44020831 missense probably damaging 1.00
R7573:Prom1 UTSW 5 44055930 missense probably damaging 0.99
R7592:Prom1 UTSW 5 44063127 missense probably damaging 0.96
R7809:Prom1 UTSW 5 44020867 missense probably benign 0.10
R8122:Prom1 UTSW 5 44012953 missense probably benign 0.12
R8187:Prom1 UTSW 5 44034366 missense probably damaging 1.00
R8195:Prom1 UTSW 5 44037428 missense possibly damaging 0.69
Z1177:Prom1 UTSW 5 44014838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTCACACCAGCACCACTTG -3'
(R):5'- ACCTGCATTTTAGTCACCTGACACC -3'

Sequencing Primer
(F):5'- CACCACTTGACTCCATAAGGTTATTG -3'
(R):5'- AGAGATTGGCTTGACTTCAGTACC -3'
Posted On2014-01-05