Incidental Mutation 'R1110:Cyp2u1'
ID96568
Institutional Source Beutler Lab
Gene Symbol Cyp2u1
Ensembl Gene ENSMUSG00000027983
Gene Namecytochrome P450, family 2, subfamily u, polypeptide 1
Synonyms
MMRRC Submission 039183-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R1110 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location131288441-131303227 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131293609 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 441 (I441T)
Ref Sequence ENSEMBL: ENSMUSP00000142519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106337] [ENSMUST00000200236]
Predicted Effect possibly damaging
Transcript: ENSMUST00000106337
AA Change: I441T

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101944
Gene: ENSMUSG00000027983
AA Change: I441T

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 69 527 4.2e-126 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198606
Predicted Effect possibly damaging
Transcript: ENSMUST00000200236
AA Change: I441T

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142519
Gene: ENSMUSG00000027983
AA Change: I441T

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 69 473 1.1e-108 PFAM
transmembrane domain 476 498 N/A INTRINSIC
Meta Mutation Damage Score 0.0680 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This enzyme is a hydroxylase that metabolizes arachidonic acid, docosahexaenoic acid, and other long chain fatty acids. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 T A 4: 155,905,399 probably null Het
Acp2 A G 2: 91,208,422 probably null Het
Akap13 T G 7: 75,611,377 S447A possibly damaging Het
Alk G A 17: 71,984,745 probably benign Het
Arhgef39 T C 4: 43,496,834 T327A probably benign Het
Cdan1 G A 2: 120,720,602 A1103V probably damaging Het
Cdh18 A G 15: 23,474,317 T758A probably benign Het
Cdk17 T A 10: 93,239,033 Y3* probably null Het
Cdon T C 9: 35,456,437 probably benign Het
Cntn3 T A 6: 102,245,158 N460I probably benign Het
Cntrl T A 2: 35,160,627 C985S possibly damaging Het
Col6a2 T C 10: 76,607,740 E497G probably benign Het
Crybg1 A G 10: 43,999,093 M673T possibly damaging Het
Disp2 T C 2: 118,790,439 S551P probably damaging Het
Dock2 A T 11: 34,256,535 F1354I possibly damaging Het
Dstyk A G 1: 132,453,325 probably benign Het
Dzip1 T C 14: 118,889,305 N527S probably benign Het
Eomes A G 9: 118,484,599 I571V probably benign Het
Fam26e T G 10: 34,096,017 I141L probably benign Het
Fbxl13 T C 5: 21,484,036 D758G probably benign Het
Frem1 T C 4: 82,950,320 S1457G probably damaging Het
Gabbr2 C T 4: 46,718,838 C613Y probably damaging Het
Gm906 A T 13: 50,248,260 D83E possibly damaging Het
Gm9755 A T 8: 67,515,058 noncoding transcript Het
Hnrnpul2 A G 19: 8,826,746 R570G probably damaging Het
Igdcc4 A G 9: 65,126,926 H674R possibly damaging Het
Kdm5d T A Y: 910,539 L250H probably damaging Het
Kif1a T C 1: 93,023,453 probably benign Het
Kmt2c T C 5: 25,314,362 N2250S probably benign Het
Kmt2e C T 5: 23,502,655 H1739Y probably damaging Het
Lmtk3 T A 7: 45,795,003 probably benign Het
Lpin3 A G 2: 160,894,079 D93G probably benign Het
Myh10 T C 11: 68,791,850 probably benign Het
Myom2 G A 8: 15,122,413 E1171K probably benign Het
Ncoa6 A T 2: 155,411,520 probably benign Het
Nup160 A G 2: 90,733,219 probably benign Het
Oit3 G A 10: 59,428,194 R373C probably damaging Het
Olfml2a A T 2: 38,959,753 I494L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Olfr824 A G 10: 130,126,653 Y135H probably damaging Het
Parp6 G T 9: 59,649,564 C584F probably damaging Het
Pcgf2 A G 11: 97,691,850 probably benign Het
Pde3a T C 6: 141,459,316 probably benign Het
Pibf1 C T 14: 99,112,973 R186C probably damaging Het
Pitrm1 A G 13: 6,558,244 D335G probably benign Het
Pkp4 T C 2: 59,338,765 L752P probably damaging Het
Plcb3 C A 19: 6,961,913 E566* probably null Het
Prune2 T C 19: 17,125,222 S2582P probably benign Het
Reln A T 5: 22,034,775 D831E probably benign Het
Samd9l T A 6: 3,374,267 D998V probably benign Het
Sardh G A 2: 27,191,919 T865I possibly damaging Het
Setbp1 G A 18: 78,857,860 T864I probably damaging Het
Slc9a1 T A 4: 133,370,548 M2K probably benign Het
Sorbs2 A G 8: 45,795,730 T593A probably benign Het
Svs5 A T 2: 164,333,587 I120L probably benign Het
Tcl1b1 G T 12: 105,159,815 V19F probably damaging Het
Ttc30a1 A T 2: 75,979,976 C588S probably damaging Het
Urgcp T C 11: 5,716,004 N778S probably benign Het
Vnn1 A T 10: 23,899,601 I250F possibly damaging Het
Xntrpc A G 7: 102,082,974 R365G possibly damaging Het
Zfp84 T A 7: 29,771,372 M1K probably null Het
Zfyve26 G A 12: 79,280,067 R761C probably damaging Het
Zp3r A G 1: 130,577,884 probably null Het
Other mutations in Cyp2u1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Cyp2u1 APN 3 131297951 missense probably damaging 1.00
IGL02365:Cyp2u1 APN 3 131298229 missense probably damaging 1.00
R0387:Cyp2u1 UTSW 3 131295552 splice site probably null
R0781:Cyp2u1 UTSW 3 131293609 missense possibly damaging 0.85
R1620:Cyp2u1 UTSW 3 131302701 missense probably damaging 0.98
R3087:Cyp2u1 UTSW 3 131303027 missense probably benign
R3845:Cyp2u1 UTSW 3 131293486 missense possibly damaging 0.66
R4996:Cyp2u1 UTSW 3 131298284 missense probably benign 0.00
R5913:Cyp2u1 UTSW 3 131303211 unclassified probably benign
R6815:Cyp2u1 UTSW 3 131298010 missense probably damaging 1.00
R6903:Cyp2u1 UTSW 3 131302775 missense probably benign 0.03
R6932:Cyp2u1 UTSW 3 131298296 missense possibly damaging 0.94
R7067:Cyp2u1 UTSW 3 131293553 missense probably damaging 1.00
R7167:Cyp2u1 UTSW 3 131303124 missense probably benign 0.23
R7193:Cyp2u1 UTSW 3 131291143 missense probably benign
R7262:Cyp2u1 UTSW 3 131297956 missense probably damaging 1.00
R7371:Cyp2u1 UTSW 3 131293495 missense probably benign 0.01
R7488:Cyp2u1 UTSW 3 131297947 missense probably damaging 1.00
R7605:Cyp2u1 UTSW 3 131297953 missense probably damaging 0.99
R7733:Cyp2u1 UTSW 3 131303027 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TCAGCAAGGCAACTCAGTAGCAAG -3'
(R):5'- GGTGACCATTTCCTCCCTGGAAAC -3'

Sequencing Primer
(F):5'- CAGTAGCAAGAACTGATTCCTTGAC -3'
(R):5'- TCCTCCCTGGAAACAGTGATG -3'
Posted On2014-01-05