Incidental Mutation 'R1110:Gabbr2'
ID96574
Institutional Source Beutler Lab
Gene Symbol Gabbr2
Ensembl Gene ENSMUSG00000039809
Gene Namegamma-aminobutyric acid (GABA) B receptor, 2
SynonymsGpr51, Gababr2, LOC242425
MMRRC Submission 039183-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R1110 (G1)
Quality Score168
Status Validated
Chromosome4
Chromosomal Location46662305-46991873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46718838 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 613 (C613Y)
Ref Sequence ENSEMBL: ENSMUSP00000103378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107749] [ENSMUST00000205643]
Predicted Effect probably damaging
Transcript: ENSMUST00000107749
AA Change: C613Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103378
Gene: ENSMUSG00000039809
AA Change: C613Y

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:Peripla_BP_6 59 434 1.5e-15 PFAM
Pfam:ANF_receptor 75 429 2e-51 PFAM
Pfam:7tm_3 492 745 6.4e-57 PFAM
PDB:4PAS|B 778 818 1e-18 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000205643
AA Change: C60Y

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.1748 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The multi-pass membrane protein encoded by this gene belongs to the G-protein coupled receptor 3 family and GABA-B receptor subfamily. The GABA-B receptors inhibit neuronal activity through G protein-coupled second-messenger systems, which regulate the release of neurotransmitters, and the activity of ion channels and adenylyl cyclase. This receptor subunit forms an active heterodimeric complex with GABA-B receptor subunit 1, neither of which is effective on its own. Allelic variants of this gene have been associated with nicotine dependence.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in clonic seizures, hyperactivity, hyperalgesia in response to thermal or mechanical stimuli, increased anxiety, and decreased depression-related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 T A 4: 155,905,399 probably null Het
Acp2 A G 2: 91,208,422 probably null Het
Akap13 T G 7: 75,611,377 S447A possibly damaging Het
Alk G A 17: 71,984,745 probably benign Het
Arhgef39 T C 4: 43,496,834 T327A probably benign Het
Cdan1 G A 2: 120,720,602 A1103V probably damaging Het
Cdh18 A G 15: 23,474,317 T758A probably benign Het
Cdk17 T A 10: 93,239,033 Y3* probably null Het
Cdon T C 9: 35,456,437 probably benign Het
Cntn3 T A 6: 102,245,158 N460I probably benign Het
Cntrl T A 2: 35,160,627 C985S possibly damaging Het
Col6a2 T C 10: 76,607,740 E497G probably benign Het
Crybg1 A G 10: 43,999,093 M673T possibly damaging Het
Cyp2u1 A G 3: 131,293,609 I441T possibly damaging Het
Disp2 T C 2: 118,790,439 S551P probably damaging Het
Dock2 A T 11: 34,256,535 F1354I possibly damaging Het
Dstyk A G 1: 132,453,325 probably benign Het
Dzip1 T C 14: 118,889,305 N527S probably benign Het
Eomes A G 9: 118,484,599 I571V probably benign Het
Fam26e T G 10: 34,096,017 I141L probably benign Het
Fbxl13 T C 5: 21,484,036 D758G probably benign Het
Frem1 T C 4: 82,950,320 S1457G probably damaging Het
Gm906 A T 13: 50,248,260 D83E possibly damaging Het
Gm9755 A T 8: 67,515,058 noncoding transcript Het
Hnrnpul2 A G 19: 8,826,746 R570G probably damaging Het
Igdcc4 A G 9: 65,126,926 H674R possibly damaging Het
Kdm5d T A Y: 910,539 L250H probably damaging Het
Kif1a T C 1: 93,023,453 probably benign Het
Kmt2c T C 5: 25,314,362 N2250S probably benign Het
Kmt2e C T 5: 23,502,655 H1739Y probably damaging Het
Lmtk3 T A 7: 45,795,003 probably benign Het
Lpin3 A G 2: 160,894,079 D93G probably benign Het
Myh10 T C 11: 68,791,850 probably benign Het
Myom2 G A 8: 15,122,413 E1171K probably benign Het
Ncoa6 A T 2: 155,411,520 probably benign Het
Nup160 A G 2: 90,733,219 probably benign Het
Oit3 G A 10: 59,428,194 R373C probably damaging Het
Olfml2a A T 2: 38,959,753 I494L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Olfr824 A G 10: 130,126,653 Y135H probably damaging Het
Parp6 G T 9: 59,649,564 C584F probably damaging Het
Pcgf2 A G 11: 97,691,850 probably benign Het
Pde3a T C 6: 141,459,316 probably benign Het
Pibf1 C T 14: 99,112,973 R186C probably damaging Het
Pitrm1 A G 13: 6,558,244 D335G probably benign Het
Pkp4 T C 2: 59,338,765 L752P probably damaging Het
Plcb3 C A 19: 6,961,913 E566* probably null Het
Prune2 T C 19: 17,125,222 S2582P probably benign Het
Reln A T 5: 22,034,775 D831E probably benign Het
Samd9l T A 6: 3,374,267 D998V probably benign Het
Sardh G A 2: 27,191,919 T865I possibly damaging Het
Setbp1 G A 18: 78,857,860 T864I probably damaging Het
Slc9a1 T A 4: 133,370,548 M2K probably benign Het
Sorbs2 A G 8: 45,795,730 T593A probably benign Het
Svs5 A T 2: 164,333,587 I120L probably benign Het
Tcl1b1 G T 12: 105,159,815 V19F probably damaging Het
Ttc30a1 A T 2: 75,979,976 C588S probably damaging Het
Urgcp T C 11: 5,716,004 N778S probably benign Het
Vnn1 A T 10: 23,899,601 I250F possibly damaging Het
Xntrpc A G 7: 102,082,974 R365G possibly damaging Het
Zfp84 T A 7: 29,771,372 M1K probably null Het
Zfyve26 G A 12: 79,280,067 R761C probably damaging Het
Zp3r A G 1: 130,577,884 probably null Het
Other mutations in Gabbr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Gabbr2 APN 4 46787600 missense probably damaging 1.00
IGL00844:Gabbr2 APN 4 46875711 missense probably damaging 1.00
IGL01584:Gabbr2 APN 4 46674524 missense probably damaging 0.97
IGL01684:Gabbr2 APN 4 46736501 missense probably benign
IGL01884:Gabbr2 APN 4 46875711 missense probably damaging 1.00
IGL02073:Gabbr2 APN 4 46667547 missense probably benign 0.00
IGL02376:Gabbr2 APN 4 46684300 missense probably damaging 1.00
R0194:Gabbr2 UTSW 4 46787565 missense possibly damaging 0.48
R0627:Gabbr2 UTSW 4 46681223 missense possibly damaging 0.92
R0685:Gabbr2 UTSW 4 46787521 missense possibly damaging 0.64
R0781:Gabbr2 UTSW 4 46718838 missense probably damaging 1.00
R0882:Gabbr2 UTSW 4 46718904 missense probably damaging 1.00
R0883:Gabbr2 UTSW 4 46677474 missense probably benign 0.00
R1004:Gabbr2 UTSW 4 46677544 missense possibly damaging 0.60
R1078:Gabbr2 UTSW 4 46664833 missense probably damaging 0.99
R1368:Gabbr2 UTSW 4 46674464 missense probably benign 0.31
R1557:Gabbr2 UTSW 4 46846436 missense probably damaging 1.00
R1577:Gabbr2 UTSW 4 46684319 missense probably benign 0.29
R1645:Gabbr2 UTSW 4 46664963 splice site probably null
R1743:Gabbr2 UTSW 4 46677603 missense possibly damaging 0.47
R1848:Gabbr2 UTSW 4 46739823 missense probably benign 0.31
R1997:Gabbr2 UTSW 4 46787502 missense probably damaging 1.00
R2009:Gabbr2 UTSW 4 46734119 missense probably damaging 1.00
R4021:Gabbr2 UTSW 4 46846435 missense probably damaging 1.00
R4719:Gabbr2 UTSW 4 46718797 missense probably damaging 0.99
R4757:Gabbr2 UTSW 4 46875675 missense probably damaging 0.98
R4798:Gabbr2 UTSW 4 46991139 missense possibly damaging 0.92
R5086:Gabbr2 UTSW 4 46724342 missense probably damaging 1.00
R5176:Gabbr2 UTSW 4 46681208 missense probably damaging 0.99
R5451:Gabbr2 UTSW 4 46684294 missense probably benign 0.15
R5510:Gabbr2 UTSW 4 46734113 missense probably damaging 1.00
R5611:Gabbr2 UTSW 4 46804105 missense probably damaging 0.98
R6049:Gabbr2 UTSW 4 46787641 missense probably damaging 1.00
R6089:Gabbr2 UTSW 4 46846448 missense probably damaging 1.00
R6118:Gabbr2 UTSW 4 46736459 missense probably damaging 1.00
R6209:Gabbr2 UTSW 4 46804069 missense probably damaging 1.00
R6212:Gabbr2 UTSW 4 46681189 missense probably damaging 0.98
R6717:Gabbr2 UTSW 4 46787574 missense possibly damaging 0.50
R7339:Gabbr2 UTSW 4 46846340 missense probably benign 0.01
R7479:Gabbr2 UTSW 4 46681166 missense probably damaging 0.98
R7695:Gabbr2 UTSW 4 46875687 missense probably damaging 1.00
R7808:Gabbr2 UTSW 4 46875744 missense possibly damaging 0.49
R7832:Gabbr2 UTSW 4 46734096 missense probably benign 0.04
R7993:Gabbr2 UTSW 4 46736349 splice site probably null
R7994:Gabbr2 UTSW 4 46736349 splice site probably null
R8051:Gabbr2 UTSW 4 46736349 splice site probably null
R8084:Gabbr2 UTSW 4 46736349 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCACTCGGATGAGCAGGTACATCG -3'
(R):5'- CCATTGAGCAGAGACTAAACGTGGC -3'

Sequencing Primer
(F):5'- GGTGCTTCCCCAATTATGACAG -3'
(R):5'- TCAACAAGTTGCAAGCGTGTC -3'
Posted On2014-01-05