Mutagenetix > Incidental Mutations

Incidental Mutation 'R1110:Frem1'

96580

Institutional Source

Beutler Lab

Gene Symbol

Frem1

Ensembl Gene

ENSMUSG00000059049

Gene Name

Fras1 related extracellular matrix protein 1

Synonyms

eyes2, heb, eye, crf11, QBRICK

MMRRC Submission

039183-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.734) question?

Stock #

R1110 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82897920-83052339 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 82950320 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 1457 (S1457G)

Ref Sequence

ENSEMBL: ENSMUSP00000125809 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071708] [ENSMUST00000107230] [ENSMUST00000170248]

AlphaFold

Q684R7

Predicted Effect

probably damaging
Transcript: ENSMUST00000071708
AA Change: S1475G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000071627
Gene: ENSMUSG00000059049
AA Change: S1475G

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Pfam:Cadherin_3	364	508	1.7e-37	PFAM
Pfam:Cadherin_3	509	623	3.7e-18	PFAM
Pfam:Cadherin_3	592	709	8.4e-16	PFAM
Pfam:Cadherin_3	746	894	4.8e-26	PFAM
Pfam:Cadherin_3	863	1009	2.8e-30	PFAM
Pfam:Cadherin_3	1024	1115	6.4e-13	PFAM
Pfam:Cadherin_3	1119	1252	1.4e-17	PFAM
Pfam:Cadherin_3	1243	1393	8.2e-35	PFAM
Pfam:Cadherin_3	1378	1506	2e-22	PFAM
Pfam:Cadherin_3	1506	1616	1e-29	PFAM
Pfam:Cadherin_3	1617	1744	1.5e-14	PFAM
Pfam:Calx-beta	1749	1848	2.6e-10	PFAM
low complexity region	1894	1910	N/A	INTRINSIC
CLECT	2065	2188	2.25e-27	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107230
AA Change: S1456G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000102849
Gene: ENSMUSG00000059049
AA Change: S1456G

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
internal_repeat_1	296	967	9.01e-39	PROSPERO
internal_repeat_1	1026	1705	9.01e-39	PROSPERO
Pfam:Calx-beta	1730	1829	6.7e-10	PFAM
low complexity region	1875	1891	N/A	INTRINSIC
CLECT	2046	2169	2.25e-27	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000127886
AA Change: S381G

SMART Domains

Protein: ENSMUSP00000122467
Gene: ENSMUSG00000059049
AA Change: S381G

Domain	Start	End	E-Value	Type
Pfam:Cadherin_3	26	158	1.1e-18	PFAM
Pfam:Cadherin_3	150	300	4.6e-36	PFAM
Pfam:Cadherin_3	285	408	6e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000170248
AA Change: S1457G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000125809
Gene: ENSMUSG00000059049
AA Change: S1457G

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Pfam:Cadherin_3	365	509	1.3e-37	PFAM
Pfam:Cadherin_3	510	623	4.5e-18	PFAM
Pfam:Cadherin_3	593	711	6.1e-16	PFAM
Pfam:Cadherin_3	728	876	2.7e-27	PFAM
Pfam:Cadherin_3	845	991	2.1e-30	PFAM
Pfam:Cadherin_3	1006	1097	4.8e-13	PFAM
Pfam:Cadherin_3	1101	1234	1e-17	PFAM
Pfam:Cadherin_3	1225	1375	6.1e-35	PFAM
Pfam:Cadherin_3	1360	1488	1.5e-22	PFAM
Pfam:Cadherin_3	1488	1598	7.5e-30	PFAM
Pfam:Cadherin_3	1599	1726	1.1e-14	PFAM
Pfam:Calx-beta	1731	1830	6.4e-10	PFAM
low complexity region	1876	1892	N/A	INTRINSIC
CLECT	2047	2170	2.25e-27	SMART

Meta Mutation Damage Score

0.2600

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 94.3%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basement membrane protein that may play a role in craniofacial and renal development. Mutations in this gene have been associated with bifid nose with or without anorectal and renal anomalies. Alternatively spliced transcript variants encoding different isoforms have been described. PubMed ID 19940113 describes one such variant that initiates transcription within a distinct, internal exon; the resulting shorter isoform (named Toll-like/interleukin-1 receptor regulator, TILRR) is suggested to be a co-receptor of the interleukin 1 receptor family and may regulate receptor function and Toll-like receptor/interleukin 1 receptor signal transduction, contributing to the control of inflammatory response activation. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mutation of this gene results in subepidermal blistering, cryptophthalmos, syndactyly, and renal agenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acap3	T	A	4: 155,905,399		probably null	Het
Acp2	A	G	2: 91,208,422		probably null	Het
Akap13	T	G	7: 75,611,377	S447A	possibly damaging	Het
Alk	G	A	17: 71,984,745		probably benign	Het
Arhgef39	T	C	4: 43,496,834	T327A	probably benign	Het
Cdan1	G	A	2: 120,720,602	A1103V	probably damaging	Het
Cdh18	A	G	15: 23,474,317	T758A	probably benign	Het
Cdk17	T	A	10: 93,239,033	Y3*	probably null	Het
Cdon	T	C	9: 35,456,437		probably benign	Het
Cntn3	T	A	6: 102,245,158	N460I	probably benign	Het
Cntrl	T	A	2: 35,160,627	C985S	possibly damaging	Het
Col6a2	T	C	10: 76,607,740	E497G	probably benign	Het
Crybg1	A	G	10: 43,999,093	M673T	possibly damaging	Het
Cyp2u1	A	G	3: 131,293,609	I441T	possibly damaging	Het
Disp2	T	C	2: 118,790,439	S551P	probably damaging	Het
Dock2	A	T	11: 34,256,535	F1354I	possibly damaging	Het
Dstyk	A	G	1: 132,453,325		probably benign	Het
Dzip1	T	C	14: 118,889,305	N527S	probably benign	Het
Eomes	A	G	9: 118,484,599	I571V	probably benign	Het
Fam26e	T	G	10: 34,096,017	I141L	probably benign	Het
Fbxl13	T	C	5: 21,484,036	D758G	probably benign	Het
Gabbr2	C	T	4: 46,718,838	C613Y	probably damaging	Het
Gm906	A	T	13: 50,248,260	D83E	possibly damaging	Het
Gm9755	A	T	8: 67,515,058		noncoding transcript	Het
Hnrnpul2	A	G	19: 8,826,746	R570G	probably damaging	Het
Igdcc4	A	G	9: 65,126,926	H674R	possibly damaging	Het
Kdm5d	T	A	Y: 910,539	L250H	probably damaging	Het
Kif1a	T	C	1: 93,023,453		probably benign	Het
Kmt2c	T	C	5: 25,314,362	N2250S	probably benign	Het
Kmt2e	C	T	5: 23,502,655	H1739Y	probably damaging	Het
Lmtk3	T	A	7: 45,795,003		probably benign	Het
Lpin3	A	G	2: 160,894,079	D93G	probably benign	Het
Myh10	T	C	11: 68,791,850		probably benign	Het
Myom2	G	A	8: 15,122,413	E1171K	probably benign	Het
Ncoa6	A	T	2: 155,411,520		probably benign	Het
Nup160	A	G	2: 90,733,219		probably benign	Het
Oit3	G	A	10: 59,428,194	R373C	probably damaging	Het
Olfml2a	A	T	2: 38,959,753	I494L	probably damaging	Het
Olfr743	T	C	14: 50,533,702	S97P	possibly damaging	Het
Olfr824	A	G	10: 130,126,653	Y135H	probably damaging	Het
Parp6	G	T	9: 59,649,564	C584F	probably damaging	Het
Pcgf2	A	G	11: 97,691,850		probably benign	Het
Pde3a	T	C	6: 141,459,316		probably benign	Het
Pibf1	C	T	14: 99,112,973	R186C	probably damaging	Het
Pitrm1	A	G	13: 6,558,244	D335G	probably benign	Het
Pkp4	T	C	2: 59,338,765	L752P	probably damaging	Het
Plcb3	C	A	19: 6,961,913	E566*	probably null	Het
Prune2	T	C	19: 17,125,222	S2582P	probably benign	Het
Reln	A	T	5: 22,034,775	D831E	probably benign	Het
Samd9l	T	A	6: 3,374,267	D998V	probably benign	Het
Sardh	G	A	2: 27,191,919	T865I	possibly damaging	Het
Setbp1	G	A	18: 78,857,860	T864I	probably damaging	Het
Slc9a1	T	A	4: 133,370,548	M2K	probably benign	Het
Sorbs2	A	G	8: 45,795,730	T593A	probably benign	Het
Svs5	A	T	2: 164,333,587	I120L	probably benign	Het
Tcl1b1	G	T	12: 105,159,815	V19F	probably damaging	Het
Ttc30a1	A	T	2: 75,979,976	C588S	probably damaging	Het
Urgcp	T	C	11: 5,716,004	N778S	probably benign	Het
Vnn1	A	T	10: 23,899,601	I250F	possibly damaging	Het
Xntrpc	A	G	7: 102,082,974	R365G	possibly damaging	Het
Zfp84	T	A	7: 29,771,372	M1K	probably null	Het
Zfyve26	G	A	12: 79,280,067	R761C	probably damaging	Het
Zp3r	A	G	1: 130,577,884		probably null	Het

Other mutations in Frem1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Frem1	APN	4	82959389	missense	possibly damaging	0.46
IGL01069:Frem1	APN	4	83013867	missense	probably benign	0.00
IGL01106:Frem1	APN	4	82922257	missense	probably benign	0.00
IGL01398:Frem1	APN	4	82950362	missense	possibly damaging	0.64
IGL01617:Frem1	APN	4	82936139	missense	probably benign	0.02
IGL01647:Frem1	APN	4	82950356	missense	possibly damaging	0.60
IGL01690:Frem1	APN	4	82959296	splice site	probably benign
IGL02006:Frem1	APN	4	82992800	critical splice donor site	probably null
IGL02069:Frem1	APN	4	82903551	missense	probably damaging	1.00
IGL02131:Frem1	APN	4	82924854	missense	probably benign	0.03
IGL02225:Frem1	APN	4	82940506	missense	probably damaging	1.00
IGL02439:Frem1	APN	4	82956345	missense	probably benign	0.00
IGL02567:Frem1	APN	4	83000055	missense	probably damaging	1.00
IGL02647:Frem1	APN	4	83001754	missense	probably damaging	1.00
IGL02653:Frem1	APN	4	82959334	missense	probably benign	0.22
IGL02831:Frem1	APN	4	82956158	missense	probably benign	0.31
IGL02997:Frem1	APN	4	82934968	missense	probably damaging	1.00
IGL03005:Frem1	APN	4	82994134	missense	probably damaging	1.00
IGL03036:Frem1	APN	4	82959339	missense	possibly damaging	0.55
IGL03193:Frem1	APN	4	82994026	splice site	probably benign
IGL03218:Frem1	APN	4	82914646	missense	probably benign	0.00
IGL03235:Frem1	APN	4	83020755	missense	possibly damaging	0.87
IGL03243:Frem1	APN	4	83013969	missense	probably damaging	1.00
bat	UTSW	4	82983060	intron	probably benign
blister	UTSW	4	83020770	missense	probably benign	0.28
R0519_frem1_373	UTSW	4	82970633	critical splice donor site	probably null
R4764_Frem1_085	UTSW	4	82989189	missense	probably damaging	1.00
R6165_Frem1_083	UTSW	4	82956255	missense	probably benign	0.16
R6324_Frem1_643	UTSW	4	82983337	missense	probably benign	0.00
PIT4131001:Frem1	UTSW	4	83005808	missense	probably damaging	0.99
PIT4466001:Frem1	UTSW	4	82972137	missense	probably benign	0.01
PIT4472001:Frem1	UTSW	4	82972137	missense	probably benign	0.01
PIT4515001:Frem1	UTSW	4	82900426	missense	probably damaging	0.98
PIT4531001:Frem1	UTSW	4	82950280	missense	probably benign	0.12
R0010:Frem1	UTSW	4	83000098	missense	probably benign	0.41
R0010:Frem1	UTSW	4	83000098	missense	probably benign	0.41
R0115:Frem1	UTSW	4	82936169	missense	possibly damaging	0.94
R0125:Frem1	UTSW	4	83011951	missense	probably damaging	1.00
R0280:Frem1	UTSW	4	82969444	missense	probably damaging	1.00
R0504:Frem1	UTSW	4	82912637	missense	probably benign	0.26
R0519:Frem1	UTSW	4	82970633	critical splice donor site	probably null
R0631:Frem1	UTSW	4	82972165	missense	probably damaging	1.00
R0645:Frem1	UTSW	4	82989166	missense	probably damaging	1.00
R0781:Frem1	UTSW	4	82950320	missense	probably damaging	0.99
R1115:Frem1	UTSW	4	83020770	missense	probably benign	0.28
R1130:Frem1	UTSW	4	82916628	splice site	probably null
R1173:Frem1	UTSW	4	82950352	missense	probably benign	0.16
R1349:Frem1	UTSW	4	82922305	splice site	probably benign
R1464:Frem1	UTSW	4	83011879	missense	probably damaging	1.00
R1464:Frem1	UTSW	4	83011879	missense	probably damaging	1.00
R1658:Frem1	UTSW	4	83001808	missense	probably damaging	1.00
R1672:Frem1	UTSW	4	82998891	missense	probably benign	0.09
R1831:Frem1	UTSW	4	83020837	missense	possibly damaging	0.95
R1851:Frem1	UTSW	4	82950500	missense	probably damaging	0.98
R2014:Frem1	UTSW	4	83005852	missense	probably damaging	1.00
R2021:Frem1	UTSW	4	82913558	missense	probably benign	0.02
R2022:Frem1	UTSW	4	82913558	missense	probably benign	0.02
R2023:Frem1	UTSW	4	82913558	missense	probably benign	0.02
R2183:Frem1	UTSW	4	82991495	missense	probably benign	0.00
R2437:Frem1	UTSW	4	83000173	missense	probably damaging	1.00
R2520:Frem1	UTSW	4	82950290	missense	probably damaging	0.99
R3195:Frem1	UTSW	4	83014114	missense	probably damaging	0.99
R3196:Frem1	UTSW	4	83014114	missense	probably damaging	0.99
R3408:Frem1	UTSW	4	83011986	missense	probably damaging	1.00
R3411:Frem1	UTSW	4	82963179	missense	possibly damaging	0.51
R3742:Frem1	UTSW	4	83011867	missense	probably damaging	1.00
R3829:Frem1	UTSW	4	82998930	missense	probably damaging	1.00
R3888:Frem1	UTSW	4	82913607	missense	probably benign	0.41
R4329:Frem1	UTSW	4	82986537	missense	probably benign	0.01
R4364:Frem1	UTSW	4	82913251	missense	probably damaging	0.99
R4411:Frem1	UTSW	4	82963244	missense	probably damaging	1.00
R4624:Frem1	UTSW	4	82989106	missense	probably damaging	1.00
R4687:Frem1	UTSW	4	83020631	missense	probably damaging	1.00
R4764:Frem1	UTSW	4	82989189	missense	probably damaging	1.00
R4801:Frem1	UTSW	4	82916628	splice site	probably benign
R4802:Frem1	UTSW	4	82916628	splice site	probably benign
R4854:Frem1	UTSW	4	82916758	missense	possibly damaging	0.88
R4872:Frem1	UTSW	4	82963150	missense	probably damaging	1.00
R4947:Frem1	UTSW	4	82966134	missense	probably damaging	0.99
R5007:Frem1	UTSW	4	82940812	intron	probably benign
R5103:Frem1	UTSW	4	82991612	missense	probably benign
R5369:Frem1	UTSW	4	83001739	missense	possibly damaging	0.61
R5494:Frem1	UTSW	4	82940753	makesense	probably null
R5694:Frem1	UTSW	4	82994116	missense	probably damaging	1.00
R5780:Frem1	UTSW	4	82950415	missense	probably benign	0.12
R5813:Frem1	UTSW	4	83000158	missense	probably damaging	1.00
R5843:Frem1	UTSW	4	82936052	missense	probably damaging	1.00
R5914:Frem1	UTSW	4	83001775	missense	probably damaging	1.00
R5985:Frem1	UTSW	4	82966050	missense	probably benign
R6091:Frem1	UTSW	4	82900559	missense	probably benign	0.01
R6165:Frem1	UTSW	4	82956255	missense	probably benign	0.16
R6324:Frem1	UTSW	4	82983337	missense	probably benign	0.00
R6369:Frem1	UTSW	4	82913792	splice site	probably null
R6414:Frem1	UTSW	4	82940536	missense	probably damaging	0.98
R6421:Frem1	UTSW	4	82994128	missense	probably damaging	1.00
R6434:Frem1	UTSW	4	82966016	missense	probably benign	0.03
R6453:Frem1	UTSW	4	82914825	nonsense	probably null
R6598:Frem1	UTSW	4	83013828	missense	probably damaging	0.99
R6720:Frem1	UTSW	4	83013832	missense	probably damaging	0.98
R6862:Frem1	UTSW	4	83012014	nonsense	probably null
R6922:Frem1	UTSW	4	82922269	missense	probably damaging	1.00
R6931:Frem1	UTSW	4	82970677	missense	probably damaging	1.00
R6992:Frem1	UTSW	4	82940362	missense	possibly damaging	0.62
R6995:Frem1	UTSW	4	82986601	missense	probably damaging	1.00
R7001:Frem1	UTSW	4	82986561	missense	probably benign	0.44
R7104:Frem1	UTSW	4	82940681	missense	probably benign	0.30
R7146:Frem1	UTSW	4	82922295	missense	possibly damaging	0.93
R7174:Frem1	UTSW	4	82922256	missense	probably benign	0.00
R7327:Frem1	UTSW	4	83020755	missense	possibly damaging	0.87
R7343:Frem1	UTSW	4	82994122	missense	probably damaging	0.99
R7368:Frem1	UTSW	4	82966144	missense	probably benign	0.19
R7392:Frem1	UTSW	4	83013827	missense	probably benign	0.06
R7465:Frem1	UTSW	4	82914835	missense	probably benign	0.11
R7499:Frem1	UTSW	4	83005770	missense	probably damaging	1.00
R7536:Frem1	UTSW	4	82956195	missense	probably damaging	1.00
R7752:Frem1	UTSW	4	82959377	missense	probably benign	0.02
R7753:Frem1	UTSW	4	82913980	missense	probably benign	0.03
R7790:Frem1	UTSW	4	82989164	missense	probably benign	0.02
R7818:Frem1	UTSW	4	83014008	missense	probably damaging	1.00
R7877:Frem1	UTSW	4	83013812	critical splice donor site	probably null
R7878:Frem1	UTSW	4	83020680	missense	probably benign	0.00
R7886:Frem1	UTSW	4	83016406	missense	possibly damaging	0.68
R7901:Frem1	UTSW	4	82959377	missense	probably benign	0.02
R7976:Frem1	UTSW	4	83001709	missense	probably damaging	0.97
R8240:Frem1	UTSW	4	82956248	missense	probably benign	0.21
R8305:Frem1	UTSW	4	82999989	missense	probably benign	0.06
R8415:Frem1	UTSW	4	83000262	missense	probably damaging	1.00
R8751:Frem1	UTSW	4	82970778	missense	probably damaging	1.00
R8819:Frem1	UTSW	4	82903517	missense	probably damaging	1.00
R8820:Frem1	UTSW	4	82903517	missense	probably damaging	1.00
R8829:Frem1	UTSW	4	83000194	missense	probably damaging	1.00
R8834:Frem1	UTSW	4	83004373	missense	probably damaging	1.00
R8857:Frem1	UTSW	4	83004043	intron	probably benign
R8910:Frem1	UTSW	4	82950457	missense	probably benign	0.09
R9036:Frem1	UTSW	4	82913548	missense	probably benign
R9228:Frem1	UTSW	4	83001820	missense	probably damaging	1.00
R9382:Frem1	UTSW	4	82983385	missense	possibly damaging	0.79
R9441:Frem1	UTSW	4	83005846	missense	probably damaging	1.00
X0013:Frem1	UTSW	4	82914808	missense	probably benign	0.38
X0017:Frem1	UTSW	4	82991633	critical splice acceptor site	probably null
Z1088:Frem1	UTSW	4	82972267	missense	probably damaging	1.00
Z1176:Frem1	UTSW	4	82999983	missense	probably damaging	1.00
Z1177:Frem1	UTSW	4	82940315	critical splice donor site	probably null
Z1177:Frem1	UTSW	4	83000269	missense	probably benign	0.39
Z1177:Frem1	UTSW	4	83016464	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTCAGAGAAGGGCTTGGACGC -3'
(R):5'- CACTCGTGGTAGTCAAAGGTGACAG -3'

Sequencing Primer
(F):5'- CTGTGTATCCATAAGCAACGTC -3'
(R):5'- GTAGTCAAAGGTGACAGAGGTC -3'

Posted On

2014-01-05