Mutagenetix > Incidental Mutation

Incidental Mutation 'R1018:Lrig1'

96581

Institutional Source

Beutler Lab

Gene Symbol

Lrig1

Ensembl Gene

ENSMUSG00000030029

Gene Name

leucine-rich repeats and immunoglobulin-like domains 1

Synonyms

LIG-1, Img

MMRRC Submission

039122-MU

Accession Numbers

Genbank: NM_008377; MGI: 107935

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1018 (G1)

Quality Score

178

Status

Validated

Chromosome

Chromosomal Location

94604529-94700158 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 94622602 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000144963 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032105] [ENSMUST00000101126] [ENSMUST00000204645]

AlphaFold

P70193

Predicted Effect

probably benign
Transcript: ENSMUST00000032105

SMART Domains

Protein: ENSMUSP00000032105
Gene: ENSMUSG00000030029

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
LRRNT	42	74	5.82e-6	SMART
LRR	68	92	4.83e0	SMART
LRR	93	115	9.96e-1	SMART
LRR	142	163	6.22e0	SMART
LRR	166	187	1.81e1	SMART
LRR	190	212	5.72e0	SMART
LRR	213	235	1.06e1	SMART
LRR_TYP	236	259	2.79e-4	SMART
LRR	260	283	2.54e1	SMART
LRR	284	307	9.96e-1	SMART
LRR	308	331	4.21e1	SMART
LRR_TYP	332	355	8.6e-5	SMART
LRR	356	382	1.06e1	SMART
LRR	383	406	9.96e-1	SMART
LRR_TYP	407	430	3.34e-2	SMART
LRRCT	442	492	3.5e-15	SMART
IGc2	509	586	1.34e-4	SMART
IGc2	613	681	2.87e-13	SMART
IGc2	707	772	6.44e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000101126

SMART Domains

Protein: ENSMUSP00000098686
Gene: ENSMUSG00000030029

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
LRRNT	42	74	5.82e-6	SMART
LRR	68	92	4.83e0	SMART
LRR	93	115	9.96e-1	SMART
LRR	142	163	6.22e0	SMART
LRR	166	187	1.81e1	SMART
LRR	190	212	5.72e0	SMART
LRR	213	235	1.06e1	SMART
LRR_TYP	236	259	2.79e-4	SMART
LRR	260	283	2.54e1	SMART
LRR	284	307	9.96e-1	SMART
LRR	308	331	4.21e1	SMART
LRR_TYP	332	355	8.6e-5	SMART
LRR	356	382	1.06e1	SMART
LRR	383	406	9.96e-1	SMART
LRR_TYP	407	430	3.34e-2	SMART
LRRCT	442	492	3.5e-15	SMART
IGc2	509	586	1.34e-4	SMART
IGc2	613	681	2.87e-13	SMART
IGc2	707	772	6.44e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141014

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150811

Predicted Effect

probably benign
Transcript: ENSMUST00000204645

SMART Domains

Protein: ENSMUSP00000144963
Gene: ENSMUSG00000030029

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
LRRNT	42	74	5.82e-6	SMART
LRR	68	92	4.83e0	SMART
LRR	93	115	9.96e-1	SMART
LRR	142	163	6.22e0	SMART
LRR	166	187	1.81e1	SMART
LRR	190	212	5.72e0	SMART
LRR	213	235	1.06e1	SMART
LRR_TYP	236	259	2.79e-4	SMART
LRR	260	283	2.54e1	SMART
LRR	284	307	9.96e-1	SMART
LRR	308	331	4.21e1	SMART
LRR_TYP	332	355	8.6e-5	SMART
LRR	356	382	1.06e1	SMART
LRR	383	406	9.96e-1	SMART
LRR_TYP	407	430	3.34e-2	SMART
LRRCT	442	492	3.5e-15	SMART
IGc2	509	586	1.34e-4	SMART
IGc2	613	681	2.87e-13	SMART
IGc2	707	772	6.44e-16	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.7%

Validation Efficiency

100% (50/50)

MGI Phenotype

Strain: 2675424
PHENOTYPE: Homozygous null mice developed psoriasiform epidermal hyperplasia. Homozygotes exhibit hair follicle, epidermis, vertebral, eye and hearing abnormalities, decreased body size and fat amount, and increased susceptibility to bacterial infection. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted(4) Gene trapped(1)

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	G	T	10: 80,001,491	C403F	probably damaging	Het
Adam20	C	T	8: 40,796,109	Q419*	probably null	Het
Ankrd36	C	T	11: 5,646,876		probably benign	Het
Arl8b	T	A	6: 108,818,611	I170K	probably damaging	Het
Atp5f1	A	T	3: 105,954,172	V78E	possibly damaging	Het
Car9	G	T	4: 43,512,439		probably null	Het
Cgnl1	A	G	9: 71,726,058	Y4H	probably damaging	Het
Cnn2	T	C	10: 79,993,563	C176R	probably damaging	Het
Dst	A	G	1: 34,194,093	D3392G	probably damaging	Het
Eed	T	C	7: 89,967,811		probably benign	Het
Efl1	T	A	7: 82,763,013	V870E	possibly damaging	Het
Epx	T	C	11: 87,869,303	N495S	probably benign	Het
Fbxw20	T	A	9: 109,221,336	Y407F	probably benign	Het
Gbp9	T	A	5: 105,080,260	Q552L	probably benign	Het
Hspa13	C	A	16: 75,761,276	V134L	possibly damaging	Het
Il16	T	C	7: 83,674,538	N268S	probably damaging	Het
Kif14	G	A	1: 136,495,841		probably benign	Het
Myo7a	T	A	7: 98,107,005	D29V	probably damaging	Het
Nsd2	A	G	5: 33,843,241	K34R	probably damaging	Het
Olfr1234	C	A	2: 89,363,179	L83F	possibly damaging	Het
P3h1	C	A	4: 119,237,907	T287K	probably damaging	Het
Pkhd1	A	T	1: 20,201,259	H3023Q	possibly damaging	Het
Plxna1	A	G	6: 89,342,960	L535P	probably damaging	Het
Ppp1r32	A	T	19: 10,479,460		probably benign	Het
Prom1	A	T	5: 44,029,714	S400R	probably benign	Het
Psap	T	G	10: 60,300,811	L523R	probably damaging	Het
Psme4	C	T	11: 30,804,310	T189I	probably damaging	Het
Ptpn12	A	T	5: 21,029,869	S39T	possibly damaging	Het
Qtrt2	T	A	16: 43,878,000	H98L	possibly damaging	Het
Rad54l2	C	A	9: 106,712,390	C601F	probably benign	Het
Sfswap	A	G	5: 129,554,576	K756R	possibly damaging	Het
Slc24a5	T	C	2: 125,068,907	V86A	probably damaging	Het
Srrm2	T	C	17: 23,822,540	S2575P	probably damaging	Het
Stam	T	C	2: 14,117,374		probably benign	Het
Tbx6	T	A	7: 126,783,192		probably benign	Het
Tmem131	A	C	1: 36,794,819	F1727V	probably damaging	Het
Tpr	T	A	1: 150,442,183	H2147Q	possibly damaging	Het
Trio	T	A	15: 27,871,171	H620L	probably damaging	Het
Uba5	T	C	9: 104,049,903	T292A	probably benign	Het
Unc5a	T	A	13: 54,990,952	V48E	possibly damaging	Het
Upf1	G	T	8: 70,338,906	H514Q	possibly damaging	Het
Usp9y	A	G	Y: 1,341,414		probably benign	Het
Vmn2r6	T	A	3: 64,556,840	D191V	probably benign	Het
Wapl	T	C	14: 34,691,906	Y242H	possibly damaging	Het
Zfp341	A	T	2: 154,646,052	N812Y	probably damaging	Het
Zfp358	C	A	8: 3,496,843	S475*	probably null	Het
Zfp957	C	A	14: 79,212,742	C539F	probably damaging	Het

Other mutations in Lrig1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00474:Lrig1	APN	6	94611404	missense	probably damaging	0.99
IGL01356:Lrig1	APN	6	94654920	missense	probably benign	0.00
IGL01356:Lrig1	APN	6	94609893	missense	probably damaging	1.00
IGL02001:Lrig1	APN	6	94607324	missense	probably benign	0.00
IGL02019:Lrig1	APN	6	94616429	missense	probably damaging	0.98
IGL02177:Lrig1	APN	6	94663996	missense	possibly damaging	0.76
IGL02274:Lrig1	APN	6	94663938	missense	possibly damaging	0.90
IGL03197:Lrig1	APN	6	94606118	missense	probably benign
IGL03263:Lrig1	APN	6	94611647	missense	probably benign	0.00
IGL03327:Lrig1	APN	6	94606123	missense	probably benign	0.10
N/A - 293:Lrig1	UTSW	6	94609087	missense	probably benign
R0019:Lrig1	UTSW	6	94607349	nonsense	probably null
R0019:Lrig1	UTSW	6	94607349	nonsense	probably null
R0961:Lrig1	UTSW	6	94663914	splice site	probably benign
R1381:Lrig1	UTSW	6	94606130	missense	probably benign	0.04
R1473:Lrig1	UTSW	6	94607313	missense	probably benign	0.16
R1498:Lrig1	UTSW	6	94627987	missense	possibly damaging	0.89
R1888:Lrig1	UTSW	6	94654878	missense	probably benign	0.03
R1888:Lrig1	UTSW	6	94654878	missense	probably benign	0.03
R2273:Lrig1	UTSW	6	94608143	missense	probably damaging	1.00
R2513:Lrig1	UTSW	6	94617366	splice site	probably null
R3001:Lrig1	UTSW	6	94608777	missense	probably damaging	1.00
R3002:Lrig1	UTSW	6	94608777	missense	probably damaging	1.00
R3732:Lrig1	UTSW	6	94611576	missense	possibly damaging	0.86
R3732:Lrig1	UTSW	6	94611576	missense	possibly damaging	0.86
R3733:Lrig1	UTSW	6	94611576	missense	possibly damaging	0.86
R3772:Lrig1	UTSW	6	94605817	missense	probably benign	0.00
R4089:Lrig1	UTSW	6	94609859	missense	possibly damaging	0.83
R4093:Lrig1	UTSW	6	94613578	missense	probably benign	0.10
R4095:Lrig1	UTSW	6	94613578	missense	probably benign	0.10
R4225:Lrig1	UTSW	6	94622658	missense	probably damaging	1.00
R4917:Lrig1	UTSW	6	94609719	missense	probably damaging	1.00
R4951:Lrig1	UTSW	6	94663978	missense	probably damaging	1.00
R4976:Lrig1	UTSW	6	94625062	missense	probably damaging	1.00
R5000:Lrig1	UTSW	6	94611449	missense	probably damaging	1.00
R5149:Lrig1	UTSW	6	94628044	missense	possibly damaging	0.93
R5732:Lrig1	UTSW	6	94699539	nonsense	probably null
R5988:Lrig1	UTSW	6	94628042	missense	probably damaging	0.99
R6064:Lrig1	UTSW	6	94626447	missense	probably damaging	1.00
R6292:Lrig1	UTSW	6	94616445	missense	probably damaging	1.00
R6723:Lrig1	UTSW	6	94626405	missense	probably damaging	1.00
R6815:Lrig1	UTSW	6	94625029	missense	probably damaging	1.00
R6889:Lrig1	UTSW	6	94625063	missense	probably benign	0.07
R6995:Lrig1	UTSW	6	94611629	missense	possibly damaging	0.95
R7404:Lrig1	UTSW	6	94626471	missense	probably damaging	1.00
R7487:Lrig1	UTSW	6	94606118	missense	probably benign
R7732:Lrig1	UTSW	6	94626377	missense	probably benign	0.05
R7915:Lrig1	UTSW	6	94630101	critical splice donor site	probably null
R8133:Lrig1	UTSW	6	94611629	missense	possibly damaging	0.95
R8768:Lrig1	UTSW	6	94654859	missense	possibly damaging	0.88
R9045:Lrig1	UTSW	6	94608707	critical splice donor site	probably null
R9227:Lrig1	UTSW	6	94630132	missense	probably damaging	1.00
Z1176:Lrig1	UTSW	6	94609026	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- CTCATCCTGCAATAGGCACCACTG -3'
(R):5'- TGTGGCATGAGACACAACTGAAGAC -3'

Sequencing Primer
(F):5'- CTGCTCAGTAAAGGAAGGATTTAAC -3'
(R):5'- ACATAGCTGCTCAGTGGTGAC -3'

Posted On

2014-01-05